The endosymbiosis theory postulates that the mitochondria of eukaryotes evolve from an aerobic bacteria. In recent times, the discovery of the Mimivirus was hailed as a missing link between a virus and a bacteria. However, it is also a fact that the Mimivirus possesses a genome of a size that is comparable to the other bacteria. The mimivirus also possesses genes that are involved in nucleotide and amino acid synthesis, which some bacteria lacked. It also possesses an inner lipid membrane. I was speculating on a model of endosymbiosis whereby the ancestral virion particle like the mimvirus enters a prokaryotic cell. This virus may have accumulated mutations resulting in a defect in assembly of viral coat. As it may have coded for genes that may be beneficial to the prokaryote, it forms a symbiotic relationship with the host. It may be possible that the virus is the ancestor of the nucleus in a modern day eukaryotic cell. Like a nucleus, it can take over the role in controlling the cells.
Saturday, April 28, 2007
Sunday, April 22, 2007
Mimivirus, the hope for medicine?
The Mimivirus is the largest known virus known to mankind. It has a size of up to 600 nm. Another amazing thing about this virus is that it harbors a level of complexity which brings it closer in relation to our modern cells, with 911 genes (Prescott, 1993) encoding proteins like the amino - acyl tRNA synthetases, DNA polymerases and other metabolic enzymes. The size of its genome is 1.2 megabase (La Scola et al, 2003). Perhaps the size of the Mimivirus virion is large enough to deliver a human minichromosome into the cell. However, the capsid needs to be engineered in such a way that it can bind to receptors of specific cells. Another challenge would be to package the minichromosome into the viral capsid. If the artificial chromosome is going to be the next thing in gene therapy, the search for a nanoparticle that can act as its carrier continues.
Citations
1) Prescott, L. (1993). Microbiology, Wm. C. Brown Publishers
2) La Scola B, Audic S, Robert C, Jungang L, de Lamballerie X, Drancourt M, Birtles R, Claverie JM, Raoult D. A giant virus in amoebae. Science. 2003 Mar 28;299
Saturday, April 21, 2007
Study of the effects of trans-acting factors encoded by viruses
The proteins encoded by viruses can affect the cell in more ways than one. Thus, it would be interesting to study the long term effects of trans-acting factors encoded by the viruses on cells. One approach may be to integrate the virus's genome into that of the cell's like how a normal virus would infect a cell. The problem is that the virus may integrate in a location within genome whereby the integrated viral DNA element may affect the function and expression of neighbouring genes. In the end, our observations may be affected. I was wondering if it is possible to introduce an artifical chromosome with an integrated viral element instead. It would allow us to study the effects of trans-acting elements encoded by the virus on cells' functions and the long term effect on the cell.
Friday, April 20, 2007
New drug delivery methods delivered at delivering artificial chromosomes aimed at gene therapy
The use of viral vectors in gene therapy has a severe setback - the risk of cancer. Understandably, viruses have potent promoters and if integrated into a region where an oncogene is found, there is a possibility that cancer can arise. The use of artificial chromosome is attractive as it doesn't disrupt the original genome of the cell and is also capable of replicating. However, it's may be too big to be packaged into viral particles. The advantage of having a viral nanoparticle is its target specificity. However, research on nanoparticles is currently ongoing and before long, we may have a nanoparticle large enough, but having the properties of viral protein coats for target specificity in order to deliver the artificial chromosomes into mammalian cells. I think the artificial chromosome is the future direction of gene therapy but "drug" delivery methods have to be worked on.
Citations
1) New cancer case halts US gene therapy trials. http://www.newscientist.com/article.ns?id=dn3271
2) Human minichromosomes. http://bric.postech.ac.kr/science/97now/01_5now/010504c.html
Artificial chromosomes and their promise in research
Genetics research has come a long way since the discovery of the DNA double helix by Watson and Crick. It's now possible to construct mammalian artificial chromosomes. Ways have been discovered to induce stable gene expression from a mammalian artifical chromosome (Grimes et al, 2001). There have also been improved methods in delivery of artificial chromosomes to mammalian cells (Chen et al, 1997). Indeed, it's a great way to study trans-acting factors being expressed on a long term basis WITHOUT disrupting the original genome in cell-lines.
Citations
1) Grimes BR, Schindelhauer D, McGill NI, Ross A, Ebersole TA, Cooke HJ. Stable gene expression from a mammalian artificial chromosome. EMBO Rep. 2001 Oct;2(10):910-4.
2) Chen M, Compton ST, Coviello VF, Green ED, Ashlock MA. Transient gene expression from yeast artificial chromosome DNA in mammalian cells is enhanced by adenovirus. Nucleic Acids Res. 1997 Nov 1;25(21):4416-8.
Saturday, April 14, 2007
The Civil Servant in the Emperor's court
I was inspired to write this post when I came across this piece of writing on Du Fu the poet on answers.com. http://www.answers.com/topic/du-fu
(born 712, Xiangyang, China — died 770, Hunan) Chinese poet, often considered the greatest of all time. After a traditional Confucian education, he failed the important civil service examinations and consequently spent much of his life wandering, repeatedly attempting to gain court positions, with mixed success. His early poetry, which celebrates the natural world and bemoans the passage of time, garnered him renown. He suffered periods of extreme personal hardship, and as he matured his verse began to express profound compassion for humanity. An expert in all the poetic genres of his day, he is renowned for his superb classicism and skill in prosody, though many of the subtleties of his art do not survive translation.
A renowned poet, yet I found it surprising that his ambition was to be a civil servant in the emperor's courts, hence my musings on the mind of a civil servant in the emperor's court as shown below:
I, as a civil servant in the Emperor's court acknowledge that:
1) The Emperor is the dragon and he is my overlord.
2) I am also subserviant to the empress dowager.
3) The emperor's son will be the next in line to the throne.
4) If I am under a minister, I have to serve him with unquestioning loyalty.
5) I am prepared to be punished for violating any part of the system that was put into place.
6) I have to pass important examinations if I want to be appointed in leadership roles.
7) Scholars who did better than me in the important examinations would be appointed as officials holding positions that are higher than mine.
8) A degree holder will not necessary be appointed to a civil service position.
9) Someone with a higher classification of degree will stand a better chance at appointment in the civil service than me.
10) This examination system is meritocratic.
11) The values of Confucianism in running the country.
Virology and oncology
It is known that viruses produce potent activators as well as repressors. An example of a potent transactivator is Tat, in the case of HIV viruses. These transactivators are known to increase the expression of viral genes. However, if such activators are integrated in the vicinity of an oncogene like Ras or Myc, there lies a possibility of transformation. Tat itself has a repressive function on p53, a tumor suppressor (Harrod et al, 2003). Thus, investigating the implications of viral activators and repressors on tumorigenesis is an interesting field. Using a viral vector, a gene encoding an oncogene can be joined TOGETHER with the attenuated viral genome (can synthesize activator proteins, but not others like the viral protein coat) to investigate the effects of the virus' activator function on the oncogene's expression. To investigate the effects on tumor suppressor, the gene encoding the tumor suppressor should be joined together with the attenuated viral genome (can synthesize repressor proteins, but not others like the viral protein coat) and homologous recombination with the wild type tumor suppressor within the genome should be carried out. This is to simulate the event in which the virus integrates itself in the vicinity of the tumour suppressor.
Citations
1) Harrod R, Nacsa J, Van Lint C, Hansen J, Karpova T, McNally J, Franchini G. Human immunodeficiency virus type-1 Tat/co-activator acetyltransferase interactions inhibit p53Lys-320 acetylation and p53-responsive transcription. J Biol Chem. 2003 Apr 4;278(14):12310-8.
A "BAD" day for HIV?

When the HIV virus infects a cell, usually a CD4 T cell, the reverse transcriptase generates the DNA strand from the RNA, which is then integrated into the host cell's genome. In order for the virus to activate transcription of its genes, it must be able to activate transciption in the chromatin context. Tat, a potent trans-activator was shown to associate with p300 and P/CAF in order to activate transcription (Benkirane, 1998). Tat was also shown to bind to a RNA stem loop structure known as TAR, activating HIV gene transcription (Braddock, 1993). I was wondering if a potential mode of viral therapy could take advantage of a predominance of pro-apoptotic factors over anti-apoptotic factors in inducing the cells to undergo apoptosis.
Genetic engineering can allow us to manufacture a mutant HIV virus. This mutant HIV virus should have Bad and Bax downstream of TAR. It can be generated in caspase 9 knockout cells with the help of a helper virus that allows packaging of the recombinant genome. If introduced into a HIV infected cell, the Tat encoded by HIV within the infected cell can transactivate the expression of Bad and Bax, allowing for the predomination of pro-apoptotic factors and leading to the apoptosis of the infected cell (Gavrilescu and Denkers, 2003). A "Bad" day for HIV indeed.
Citations
1) Benkirane M, Chun RF, Xiao H, Ogryzko VV, Howard BH, Nakatani Y, Jeang KT. Activation of integrated provirus requires histone acetyltransferase. p300 and P/CAF are coactivators for HIV-1 Tat. J Biol Chem. 1998 Sep 18;273(38):24898-905.
2) Braddock M, Powell R, Blanchard AD, Kingsman AJ, Kingsman SM. HIV-1 TAR RNA-binding proteins control TAT activation of translation in Xenopus oocytes. FASEB J. 1993 Jan;7(1):214-22.
3) Gavrilescu LC, Denkers EY. Apoptosis and the balance of homeostatic and pathologic responses to protozoan infection. Infect Immun. 2003 Nov;71(11):6109-15.
Wednesday, April 11, 2007
Zoonotic viruses: The jump from animals to humans and a possible mechanism for RNA editing?
Zoonosis is any infectious disease that may be transmitted from animals to human. Some may wonder what are the exact mechanisms that made the virus jump from infecting animals to infecting humans.
There are a number of studies directed at elucidating the role of RNA editing of viral genes. It was found that RNA editing at the amber/W site plays a central role in the replication scheme of the Hepatitis Delta Virus (Casey, 2002). RNA editing was also found to have downregulated the cytotoxicity of Ebola (Volchkov, 2001). In fact, RNA editing was proposed to have occurred in the case of HIV, where there are changes in the viral proteins but no changes in the RNA viral genome that is packaged within the viral particles (Berkhout, 2001 and Bourara, 2000). Thus, the question that remains could be if RNA editing in an animal host results in the synthesis of viral proteins and structurally different viral particles that makes the virus capable of being pathogens in humans and a similar RNA editing mechanism in infected humans lead to other humans being infected too?
Citations
1) Casey JL. RNA editing in hepatitis delta virus genotype III requires a branched double-hairpin RNA structure. J Virol. 2002 Aug;76(15):7385-97.
2) Volchkov VE, Volchkova VA, Muhlberger E, Kolesnikova LV, Weik M, Dolnik O, Klenk HD. Recovery of infectious Ebola virus from complementary DNA: RNA editing of the GP gene and viral cytotoxicity. Science. 2001 Mar 9;291(5510):1965-9.
3) Berkhout B, Das AT, Beerens N. HIV-1 RNA editing, hypermutation, and error-prone reverse transcription. Science. 2001 Apr 6;292(5514):7.
Monday, April 9, 2007
Anti-cancer bacteria?
I came across an interesting article describing the genetic engineering of myxobacterium in producing an anti-tumor compound (Heim). I worked on colorectal cancer, and I thought it will be interesting to be able to genetically engineer bacteria that is capable of colonizing the colon of colorectal cancer patients and produce the anti-tumor compound through fermentation of raw materials. These bacteria can also be engineered to produce anti-cancer biologics. A good example of a useful bacteria would be Lactobacillus casei Shirota strain, which we can find in Yakult.
Administering these genetically engineered bacteria will be as easy as administering Yakult.
Citations
Saturday, April 7, 2007
My exchange with NMP Siew Kum Tong on the NS issue
Disclaimer: The contents of my post were SOLELY BASED on MY EXPERIENCE. This is NOT to say that a thorough study was done. Lastly, my experiences DO NOT necessarily reflect the realities on the ground in the absence of a thorough study being conducted.
I happened to chance on NMP Siew Kum Tong's blog, and the pertinent issue of NS men was raised. The crux of the issue was based on comments raised on National Service liabilities handicapping male Singaporean's career.
I did have my fair share of job interviews, and as regards to National Service liabilities (reservist), only one raised the issue. Coincidentally, the interviewer was a Caucasian foreigner, the only foreign interviewer I had. The rest of the interviewers for my other jobs were all Singaporeans. However, I would like to qualify that this is only based on my experience and impressions of Singaporeans and foreigners shouldn't be judged on the basis of my post.
I happened to have an interview for a certain job, although I had another dream job in mind. I wasn't particularly keen on this job, but nonetheless, I attended the interview to satisfy my curiosity and also, as a learning experience. The interview went on okay until the end when the Caucasian interviewer questioned me about my National Service committments. I reassured him that if my services were very urgent to the company, there is an avenue for me to seek a deferment. I also told him that I wasn't a key appointment holder in my National Service unit.
Needless to say, I didn't get the job in the end although I landed my dream job. This is NOT TO say that I was discriminated based on National Service liability. It could also be that I wasn't too particularly keen and treated the interview as some sort of excursion trip to open my eyes. Secondly, I landed my dream job.
Speaking of my dream job, my interviewer who was to become my direct superior was a Singaporean lady. We spent most of our interview discussing the company's vision and other things relevant to my job scope. Nothing was raised about National Service issues. At the end of the day, I was thoroughly satisfied as I managed to land my dream job.
The A*STAR scholar cum Financial Analyst
I had an interesting exchange with Mr Philip Yeo about biomedical researchers equipping themselves with financial know-hows. I would think that is possible. I knew a friend who was a Ph.D. candidate and passed his Chartered Financial Analyst stage 1 and 2 examinations. His story was a little different because he subsequently grew disillusioned with his life in the laboratory and gave up his Ph.D. studies altogether. He told me that he wanted to move on to finance as a career option.
However, I think being a financial analyst is more than just "knowing the know-hows". Looking at balance sheets for the P/E ratios, liquidity numbers or studying stock market activity by looking at level II quotes, past trends, etc, aren't enough. More research has to be done on the stock option, futures, equities, bonds, etc. The typical financial analyst has to be in the know of the events concerning a company. For instance, news on a particular company buying over another company whose products can boost the current technology of the former's products, thereby increasing sales, is valuable. It doesn't come as a surprise that a typical financial analyst working for a top financial firm spends a substantial amount on his image. These typical analysts are also social animals, and having established a wide network of contacts, they are able to make informed decisions on their choice of investments.
To conclude, it's possible to do biomedical science and KNOW HOW to read financial statements. However, being a financial analyst involves more than just reading financial statements. To be a financial analyst, the proverbial scientist has to swap his lab coat for his business suit!
Story of stem cell transformation continues

I found an interesting paper describing the formation of DNA adducts in quiescent cells arrested for DNA synthesis and the necessity for the cell to enter the cell proliferation stage for DNA synthesis to occur, resulting in the repair of DNA adducts (O'Neill, 2000). However, it is also during this DNA synthesis stage that the DNA adducts are processed into cellular mutations. Thus, cell proliferation results in both repair of potentially mutagenic adducts and the processing of mutations in the remainder of the DNA adducts (Bielas and Heddle, 2000).
It is known that adult stem cells can be quiescent for a number of years. Thus, there lies the possibility that the adult stem cells could be exposed to mutagens or electrophilic agents capable of forming adducts with DNA. A portion of them can be processed into mutations when the adult stem cells start proliferating. It has also been found that oxidative stress can induce hematopoietic stem cells to proliferate (Liu and Finkel, 2006, Ito et al, 2006). The question that remains is when the adult stem cell is exposed to mutagen and stresses to the cell from reactive oxygen species, are we witnessing its transformation?
Citations
1) J. Patrick O'Neill. DNA damage, DNA repair, cell proliferation, and DNA replication: How do gene mutations result? Proc Natl Acad Sci U S A. 2000 October 10; 97(21): 11137–11139.
2) Bielas JH, Heddle JA. Proliferation is necessary for both repair and mutation in transgenic mouse cells. Proc Natl Acad Sci U S A. 2000 Oct 10;97(21):11391-6.
4) Ito K, Hirao A, Arai F, Takubo K, Matsuoka S, Miyamoto K, Ohmura M, Naka K, Hosokawa K, Ikeda Y, Suda T. Reactive oxygen species act through p38 MAPK to limit the lifespan of hematopoietic stem cells. Nat Med. 2006 Apr;12(4):446-51.
Friday, April 6, 2007
The loose cannons of stemness
It has been found that during early metastasis in breast cancer, the early disseminated cancer cells in the bone marrow of breast cancer patients have a breast cancer stem cell phenotype (Balic et al, 2006). Another group have found that mesenchymal stem cells can undergo spontaneous transformation after four to five months in culture (Rubio et al, 2005). Thus, it is likely that during early metastasis of breast cancer, transformation of adult stem cells could have occured. Therefore, it can be seen that tumors arising out of stems cells undergoing neoplastic transformation will lead to a poorer prognosis. These cancer stem cells are capable of limitless proliferation and metastasizing to the other parts of the body. I thought that knowing the type of genetic hits and the steps of progression of a normal stem cell to a cancer stem cell will allow researchers to understand the biology behind early metastasis of cancer cells with stem cell properties.
Lastly, it will be interesting to know how adult stem cells respond to factors resulting in genetic insults. Elucidating how the adult stem cells respond to oxidative stress or electrophilic direct-acting and indirect-acting compounds will allow us to evaluate the degree of susceptility of the stem cell to such insults.
Citations
1) Balic M, Lin H, Young L, Hawes D, Giuliano A, McNamara G, Datar RH, Cote RJ. Most early disseminated cancer cells detected in bone marrow of breast cancer patients have a putative breast cancer stem cell phenotype. Clin Cancer Res. 2006 Oct 1;12(19):5615-21.
1) Balic M, Lin H, Young L, Hawes D, Giuliano A, McNamara G, Datar RH, Cote RJ. Most early disseminated cancer cells detected in bone marrow of breast cancer patients have a putative breast cancer stem cell phenotype. Clin Cancer Res. 2006 Oct 1;12(19):5615-21.
2) Rubio D, Garcia-Castro J, Martin MC, de la Fuente R, Cigudosa JC, Lloyd AC, Bernad A. Spontaneous human adult stem cell transformation. Cancer Res. 2005 Apr 15;65(8):3035-9.
Mutational hits: The adult stem cell VS the differentiated cell

Comparing an adult stem cell to a normal differentiated cell, the former has the ability to colonize other tissues and differentiate into different cell types. The hematopoietic stem cells can differentiate into brain cells (neurons, oligodendrocytes and astrocytes), skeletal muscle cells, cardiac muscle cells and liver cells. Brain stem cells can differentiate into blood cells and skeletal muscle cells (National Institute of Health). Thus, bearing in mind that the adult stem cell can colonize different tissues and differentiate into different cell types, it has some form of "innate talent" to be a metastatic cell.
For a differentiated cell to turn cancerous and be capable of metastasis, it has to suffer from mutational hits for tumor suppressors, oncogenes resulting in gain of function, metastatic suppressors resulting in loss of function and inducers of metastasis resulting in gain of function especially in the process of epithelial to mesenchymal transition (Barrallo-Gimeno and Nieto, 2005).
In recent times, it is possible to culture stem cells in vitro with the various stem cell media available (Biocompare, Nature Protocols). I was thinking of a possible experiment, whereby the adult stem cells are firstly cultured and then exposed to mutagens that are capable of inducing mutational hits on its genome. This is to study the transformation of normal adult stem cells in vitro, which gives us an idea of a sequence of events involving the type of genetic insults experienced by the adult stem cells, giving rise to metastatic cancer cells with stem cell properties, which are capable of colonizing other parts of the body and giving rise to a hetergeneous population of cells.
Corrections: Added italicized words in last sentence of the paragraph
Citations
1) National Institute of Health. http://stemcells.nih.gov/info/basics/basics4.asp
2) Barrallo-Gimeno A, Nieto MA. The Snail genes as inducers of cell movement and survival: implications in development and cancer. Development. 2005 Jul;132(14):3151-61.
3) Stem Cell Media: Biocompare Buyer's guide. http://www.biocompare.com/jump/2463/Stem-Cell-Media.html
4) Neural stem cell culture. Nature Protocols. http://www.natureprotocols.com/2006/08/25/neural_stem_cell_culture_neuro.php
Thursday, April 5, 2007
Genes for Life Science teaching
Gene 1:
1 atgggaggac acaatctagt cttgattatc ttttcggtat ttttgttatc ttcctcagca
61 tatgcaagta gagtcgcaca gtttttagct cctggtgact ttgatgtgac aagtccgaaa
121 tatggtggga agcctaatac tgatattagt cagcctttgg caaatgcttg gaaagatgct
181 tgtgcagcaa caacgccaag tagagttatt gttccaaaag ggacatttca actaaaagga
241 gcagttttca aaggtccttg taaggctcct attacggttc aggttgatgg catactgcag
301 gcgccaccaa ttgaagccca attagcaaat aaagaatttt gggtgcagtt tttagaggtt
361 gagaggctca ctgtatcagg tactggaaca tttgatggtc aaggacaaaa ttcttggaaa
421 gacaacgact gcaataaaaa tccaaactgt ggaggtctag ccattaatgt gagattcgac
481 ttcgagaaaa tcacaatgaa taatgttgct aacccagtcc tcattgacca agaatactgc
541 ccatggggtc agtgtaataa acagattcca tcaaaagtca agatcagcaa tgtgagcttc
601 aagaacatta tagggacaac ttcaactgcg gaggctttga agattgtatg cgctaaaggc
661 ttgcattgtg atcaagtggt actgagtgac atagatctca agttaagtgg caaaggaact
721 cttacatctc attgtgcaaa cgtgcaaccc acgattactc gagtgccacc gcctcttgct
781 tgtgctacca aggcttgatc atattgatta gcagctagaa ataatatgga tctaaaagac
841 tttaggtgtc acgtcaaaaa aaaaaaaaaa aaaaaaaaa
Gene 2:
1 atgggaggac acaatctagt cttgattatc ttttcggtat ttttgttatc ttcctcagca
61 tatgcaagta gagtcgcaca gtttttagct cctggtgact ttgatgtgac aagtccgaaa
121 tatggtggga agcctaatac tgatattagt cagcctttgg caaatgcttg gaaagatgct
181 tgtgcagcaa caacgccaag tagagttatt gttccaaaag ggacatttca actaaaagga
241 gcagttttca aaggtccttg taaggctcct attacggttc aggttgatgg catactgcag
301 gcgccaccaa ttgaagccca attagcaaat aaagaatttt gggtgcagtt tttagaggtt
361 gagaggctca ctgtatcagg tactggaaca tttgatggtc aaggacaaaa ttcttggaaa
421 gacaacgact gcaataaaaa tccaaactgt ggaggtctag ccattaatgt gagattcgac
481 tggtgtccca ttaccctcgt ctgtgtcctt taccaccggc tatggcggtt tcccggctta
541 cagctttggg cctggtgcca acgttggccg cccagccagg accctcatcc caccgacctt
601 cttcagggat ttcgccattg gtgtggcggt gaagcccaat agcgcccaag ggggcgtgct
661 cttcgctatt accgatgctt tccagaaagt catctacctg ggcctgcggc tttcaagtgt
721 ggaggatggg cgccagcggg ttatcctcta ctacacggaa ccaggctccc acgtgtcccg
781 tgaagctgcg gttttctccg tgcccgtgat gaccaacagg tggaatcgtt ttgctgtgac
841 cgtccagggc gaagaagttg ctcttttcat ggactgtgag gaacagagcc aagtccgttt
901 ccagcgatcg tcctggcctt tgacctttga gcccagtgcc gggatctttg tgggcaatgc
961 tggagctatg gggctggaga gatttacggg ttccatacaa cagcttacca tctattcaga
1021 ccccaggacc cctgaggagc tgtgtgaagc acaagagtcc tcggcgtctg gagaagccag
1081 tgggtttcag gagatggatg aagtcgctga aatcatggaa gctgtcacct acacacaagc
1141 cccgcctaaa gaatcacacg ttgatcccat aagcgtgccc cctacttcat cctctcctgc
1201 cgaggactcg gagctttctg gtgagccggt accagaagga accccagaaa cgaacttgag
Gene 3:
1 atgggaggac acaatctagt cttgattatc ttttcggtat ttttgttatc ttcctcagca
61 tatgcaagta gagtcgcaca gtttttagct cctggtgact ttgatgtgac aagtccgaaa
121 tatggtggga agcctaatac tgatattagt cagcctttgg caaatgcttg gaaagatgct
181 tgtgcagcaa caacgccaag tagagttatt gttccaaaag ggacatttca actaaaagga
241 gcagttttca aaggtccttg taaggctcct attacggttc aggttgatgg catactgcag
301 gcgccaccaa ttgaagccca attagcaaat aaagaatttt gggtgcagtt tttagaggtt
361 gagaggctca ctgtatcagg tactggaaca tttgatggtc aaggacaaaa ttcttggaaa
421 gacaacgact gcaataaaaa tccaaactgt ggaggtctag ccattaatgt gagattcgac
481 tgaagctttt ctctctgaga atgcgggggc tgtttttaac cagtttcaga aggtctcaga
541 aggtttggga tcaggagaca aggtcctggc tcttgcaagt attgaagtgg aaaatacaag
601 aaaatgaagc actgtttgaa acaaagtgaa tactttgctg agtattttgt tgaatttggc
661 tgcagatgta tctgttttgt attaatataa ccaagttcta ggtctttcat taacttttat
721 gaaaagactt ttgcatacga tgagcctttg tagcattttt ttttttatct tggcttcatt
781 cacatttgat gataatgatg acagttttgc ggtactttac tttctaaatg tactgcattt
841 tgaaatatat gtacaaataa taaggtattg ttttgaattt ttaataaatt ggttagattt
901 tgttttagtc attttacttt tttgggtcaa gcaggaatca gtgtaatatt atccctgaca
961 agatttatta gatggcagct atactgctac aaatttggca ttctggggaa agaaagaatc
1021 atccccagga ctagggataa cattccagtg gtatttaaaa agacactggc aatttttttt
1081 tttacacccc aatgtttcca ttgactttga cagggaagat tttcaaactg ctgccacact
1141 tacagctttg aagctccacc cccccccccc caaacttgaa taacataatc atggggtcac
1201 cacgaatgaa acagtgacat ttgttggatg acccaaagtg ggaggggcca acaacaggca
1261 atcaagtttc accagttgac tttaaagggg gaaattcaaa ctgctgccaa tctaacagct
1321 ttgaggctac actcgctgaa cttgaatcac atagtcatgg ggtcagactg aatgaaaata
1381 tgattgttgg atgctgaatc ggattttacc tatttacttg gtgaaaattc aacctgctgc
Gene 4:
1 atgggaggac acaatctagt cttgattatc ttttcggtat ttttgttatc ttcctcagca
61 tatgcaagta gagtcgcaca gtttttagct cctggtgact ttgatgtgac aagtccgaaa
121 tatggtggga agcctaatac tgatattagt cagcctttgg caaatgcttg gaaagatgct
181 tgtgcagcaa caacgccaag tagagttatt gttccaaaag ggacatttca actaaaagga
241 gcagttttca aaggtccttg taaggctcct attacggttc aggttgatgg catactgcag
301 gcgccaccaa ttgaagccca attagcaaat aaagaatttt gggtgcagtt tttagaggtt
361 gagaggctca ctgtatcagg tactggaaca tttgatggtc aaggacaaaa ttcttggaaa
421 gacaacgact gcaataaaaa tccaaactgt ggaggtctag ccattaatgt gagattcgac
481 agagtgaaaa attcattagt aagggatgtg acatcactta acagcaaaaa tttccacttc
541 aatattttag ggtgtgaaca tcttacattc caacatgtca tcgtcaaagc accgggagat
601 agccctaaca cagatggaat acatatgggg cgctcaacca ggattaacat tacggacacg
661 aacatcggaa ccggagacga ttgcatatca gttggtgatg gtaccagaca actaactgta
721 agtaaggtaa gttgtggacc aggtcatgga ataagtatcg gaagtctcgg aagatacgac
781 aatgaagatg acgtcagtgg actcaatatt agagattgta ccctgagtaa tacactgaat
841 ggtgttagaa tcaagacatt tcctgcttct cctaaagcta ccaccgcctc ggatattcac
901 ttcgagaaaa tcacaatgaa taatgttgct aacccagtcc tcattgacca agaatactgc
961 ccatggggtc agtgtaataa acagattcca tcaaaagtca agatcagcaa tgtgagcttc
1021 aagaacatta tagggacaac ttcaactgcg gaggctttga agattgtatg cgctaaaggc
1081 ttgcattgtg atcaagtggt actgagtgac atagatctca agttaagtgg caaaggaact
1141 cttacatctc attgtgcaaa cgtgcaaccc acgattactc gagtgccacc gcctcttgct
1201 tgtgctacca aggcttgatc atattgatta gcagctagaa ataatatgga tctaaaagac
1261 tttaggtgtc acgtcaaaaa aaaaaaaaaa aaaaaaaaa
1 atgggaggac acaatctagt cttgattatc ttttcggtat ttttgttatc ttcctcagca
61 tatgcaagta gagtcgcaca gtttttagct cctggtgact ttgatgtgac aagtccgaaa
121 tatggtggga agcctaatac tgatattagt cagcctttgg caaatgcttg gaaagatgct
181 tgtgcagcaa caacgccaag tagagttatt gttccaaaag ggacatttca actaaaagga
241 gcagttttca aaggtccttg taaggctcct attacggttc aggttgatgg catactgcag
301 gcgccaccaa ttgaagccca attagcaaat aaagaatttt gggtgcagtt tttagaggtt
361 gagaggctca ctgtatcagg tactggaaca tttgatggtc aaggacaaaa ttcttggaaa
421 gacaacgact gcaataaaaa tccaaactgt ggaggtctag ccattaatgt gagattcgac
481 ttcgagaaaa tcacaatgaa taatgttgct aacccagtcc tcattgacca agaatactgc
541 ccatggggtc agtgtaataa acagattcca tcaaaagtca agatcagcaa tgtgagcttc
601 aagaacatta tagggacaac ttcaactgcg gaggctttga agattgtatg cgctaaaggc
661 ttgcattgtg atcaagtggt actgagtgac atagatctca agttaagtgg caaaggaact
721 cttacatctc attgtgcaaa cgtgcaaccc acgattactc gagtgccacc gcctcttgct
781 tgtgctacca aggcttgatc atattgatta gcagctagaa ataatatgga tctaaaagac
841 tttaggtgtc acgtcaaaaa aaaaaaaaaa aaaaaaaaa
Gene 2:
1 atgggaggac acaatctagt cttgattatc ttttcggtat ttttgttatc ttcctcagca
61 tatgcaagta gagtcgcaca gtttttagct cctggtgact ttgatgtgac aagtccgaaa
121 tatggtggga agcctaatac tgatattagt cagcctttgg caaatgcttg gaaagatgct
181 tgtgcagcaa caacgccaag tagagttatt gttccaaaag ggacatttca actaaaagga
241 gcagttttca aaggtccttg taaggctcct attacggttc aggttgatgg catactgcag
301 gcgccaccaa ttgaagccca attagcaaat aaagaatttt gggtgcagtt tttagaggtt
361 gagaggctca ctgtatcagg tactggaaca tttgatggtc aaggacaaaa ttcttggaaa
421 gacaacgact gcaataaaaa tccaaactgt ggaggtctag ccattaatgt gagattcgac
481 tggtgtccca ttaccctcgt ctgtgtcctt taccaccggc tatggcggtt tcccggctta
541 cagctttggg cctggtgcca acgttggccg cccagccagg accctcatcc caccgacctt
601 cttcagggat ttcgccattg gtgtggcggt gaagcccaat agcgcccaag ggggcgtgct
661 cttcgctatt accgatgctt tccagaaagt catctacctg ggcctgcggc tttcaagtgt
721 ggaggatggg cgccagcggg ttatcctcta ctacacggaa ccaggctccc acgtgtcccg
781 tgaagctgcg gttttctccg tgcccgtgat gaccaacagg tggaatcgtt ttgctgtgac
841 cgtccagggc gaagaagttg ctcttttcat ggactgtgag gaacagagcc aagtccgttt
901 ccagcgatcg tcctggcctt tgacctttga gcccagtgcc gggatctttg tgggcaatgc
961 tggagctatg gggctggaga gatttacggg ttccatacaa cagcttacca tctattcaga
1021 ccccaggacc cctgaggagc tgtgtgaagc acaagagtcc tcggcgtctg gagaagccag
1081 tgggtttcag gagatggatg aagtcgctga aatcatggaa gctgtcacct acacacaagc
1141 cccgcctaaa gaatcacacg ttgatcccat aagcgtgccc cctacttcat cctctcctgc
1201 cgaggactcg gagctttctg gtgagccggt accagaagga accccagaaa cgaacttgag
Gene 3:
1 atgggaggac acaatctagt cttgattatc ttttcggtat ttttgttatc ttcctcagca
61 tatgcaagta gagtcgcaca gtttttagct cctggtgact ttgatgtgac aagtccgaaa
121 tatggtggga agcctaatac tgatattagt cagcctttgg caaatgcttg gaaagatgct
181 tgtgcagcaa caacgccaag tagagttatt gttccaaaag ggacatttca actaaaagga
241 gcagttttca aaggtccttg taaggctcct attacggttc aggttgatgg catactgcag
301 gcgccaccaa ttgaagccca attagcaaat aaagaatttt gggtgcagtt tttagaggtt
361 gagaggctca ctgtatcagg tactggaaca tttgatggtc aaggacaaaa ttcttggaaa
421 gacaacgact gcaataaaaa tccaaactgt ggaggtctag ccattaatgt gagattcgac
481 tgaagctttt ctctctgaga atgcgggggc tgtttttaac cagtttcaga aggtctcaga
541 aggtttggga tcaggagaca aggtcctggc tcttgcaagt attgaagtgg aaaatacaag
601 aaaatgaagc actgtttgaa acaaagtgaa tactttgctg agtattttgt tgaatttggc
661 tgcagatgta tctgttttgt attaatataa ccaagttcta ggtctttcat taacttttat
721 gaaaagactt ttgcatacga tgagcctttg tagcattttt ttttttatct tggcttcatt
781 cacatttgat gataatgatg acagttttgc ggtactttac tttctaaatg tactgcattt
841 tgaaatatat gtacaaataa taaggtattg ttttgaattt ttaataaatt ggttagattt
901 tgttttagtc attttacttt tttgggtcaa gcaggaatca gtgtaatatt atccctgaca
961 agatttatta gatggcagct atactgctac aaatttggca ttctggggaa agaaagaatc
1021 atccccagga ctagggataa cattccagtg gtatttaaaa agacactggc aatttttttt
1081 tttacacccc aatgtttcca ttgactttga cagggaagat tttcaaactg ctgccacact
1141 tacagctttg aagctccacc cccccccccc caaacttgaa taacataatc atggggtcac
1201 cacgaatgaa acagtgacat ttgttggatg acccaaagtg ggaggggcca acaacaggca
1261 atcaagtttc accagttgac tttaaagggg gaaattcaaa ctgctgccaa tctaacagct
1321 ttgaggctac actcgctgaa cttgaatcac atagtcatgg ggtcagactg aatgaaaata
1381 tgattgttgg atgctgaatc ggattttacc tatttacttg gtgaaaattc aacctgctgc
Gene 4:
1 atgggaggac acaatctagt cttgattatc ttttcggtat ttttgttatc ttcctcagca
61 tatgcaagta gagtcgcaca gtttttagct cctggtgact ttgatgtgac aagtccgaaa
121 tatggtggga agcctaatac tgatattagt cagcctttgg caaatgcttg gaaagatgct
181 tgtgcagcaa caacgccaag tagagttatt gttccaaaag ggacatttca actaaaagga
241 gcagttttca aaggtccttg taaggctcct attacggttc aggttgatgg catactgcag
301 gcgccaccaa ttgaagccca attagcaaat aaagaatttt gggtgcagtt tttagaggtt
361 gagaggctca ctgtatcagg tactggaaca tttgatggtc aaggacaaaa ttcttggaaa
421 gacaacgact gcaataaaaa tccaaactgt ggaggtctag ccattaatgt gagattcgac
481 agagtgaaaa attcattagt aagggatgtg acatcactta acagcaaaaa tttccacttc
541 aatattttag ggtgtgaaca tcttacattc caacatgtca tcgtcaaagc accgggagat
601 agccctaaca cagatggaat acatatgggg cgctcaacca ggattaacat tacggacacg
661 aacatcggaa ccggagacga ttgcatatca gttggtgatg gtaccagaca actaactgta
721 agtaaggtaa gttgtggacc aggtcatgga ataagtatcg gaagtctcgg aagatacgac
781 aatgaagatg acgtcagtgg actcaatatt agagattgta ccctgagtaa tacactgaat
841 ggtgttagaa tcaagacatt tcctgcttct cctaaagcta ccaccgcctc ggatattcac
901 ttcgagaaaa tcacaatgaa taatgttgct aacccagtcc tcattgacca agaatactgc
961 ccatggggtc agtgtaataa acagattcca tcaaaagtca agatcagcaa tgtgagcttc
1021 aagaacatta tagggacaac ttcaactgcg gaggctttga agattgtatg cgctaaaggc
1081 ttgcattgtg atcaagtggt actgagtgac atagatctca agttaagtgg caaaggaact
1141 cttacatctc attgtgcaaa cgtgcaaccc acgattactc gagtgccacc gcctcttgct
1201 tgtgctacca aggcttgatc atattgatta gcagctagaa ataatatgga tctaaaagac
1261 tttaggtgtc acgtcaaaaa aaaaaaaaaa aaaaaaaaa
Teaching materials (For Life Science students only)
Partial sequence obtained after sequencing of strawberry DNA:
ccattaatgtgagattcgacagagtgaaaaattcattagtaagggatgtgacatcacttaacagcaaaaatttccacttcaatattttag ggtgtgaacatcttacattccaacatgtcatcgtcaaagcaccgggagatagccctaacacagatggaatacatatggggcgctcaacca ggattaacattacggacacgaacatcggaaccggagacgattgcatatcagttggtgatggtaccagacaactaactgtaagtaaggtaa gttgtggaccaggtcatggaataagtatcggaagtctcggaagatacgacaatgaagatgacgtcagtggactcaatattagagattgta ccctgagtaatacactgaatggtgttagaatcaagacatttcctgcttctcctaaagctaccaccgcctcggatattcac
ccattaatgtgagattcgacagagtgaaaaattcattagtaagggatgtgacatcacttaacagcaaaaatttccacttcaatattttag ggtgtgaacatcttacattccaacatgtcatcgtcaaagcaccgggagatagccctaacacagatggaatacatatggggcgctcaacca ggattaacattacggacacgaacatcggaaccggagacgattgcatatcagttggtgatggtaccagacaactaactgtaagtaaggtaa gttgtggaccaggtcatggaataagtatcggaagtctcggaagatacgacaatgaagatgacgtcagtggactcaatattagagattgta ccctgagtaatacactgaatggtgttagaatcaagacatttcctgcttctcctaaagctaccaccgcctcggatattcac
My thoughts on the evolution of a differentiated tumor cell to cancer stem cell

In an earlier comment on my blog, I mentioned about how the "Dolly effect" may possibly result in the generation of cancer stem cells. In the milieu within a tumor mass, an evolutionary fight for survival is being waged. Tumor cells are described according to their grade. Lower grade tumors (grade 1 and grade 2) are more differentiated vis-a-vis higher grade tumors (National Cancer Institute).
It's tempting to suggest an experimental approach in vitro to simulate a sequence of events that may result in the generation of cancer stem cells from differentiated cells. The scarcity of nutrients within a rapidly growing tumor mass makes the acquisition of the ability to metastasize a selective advantage. Acquiring the cancer stem cell phenotype is a step to attaining the advantage. In my suggested approach, Wnt and notch pathways can be constitutively activated through stable transfection of differentiated tumor cells. Constitutively active beta catenin can be transfected to achieve constitutive Wnt/beta catenin signaling (Baba et al, 2006). Similarly, the constitutively active form of Notch, the Notch Intracellular domain (NICD) can be transfected into cell-lines (Purow et al, 2005).
From this in-vitro study, it can be demonstrated that there is an evolutionary pressure for cancer cells to activate pathways associated with signaling in stem cells, and at the same time, the scarcity of nutrients within a tumor mass causes the cell to be arrested in Go stage of the cell cycle, inducing nuclear reprogramming. The selection pressures lead to the rise of the cancer stem cells (Gurdon et al, 2003).
Citations
1)Tumor grade: Questions and Answers. National Cancer Institute. http://www.cancer.gov/cancertopics/factsheet/Detection/tumor-grade
2) Baba Y, Yokota T, Spits H, Garrett KP, Hayashi S, Kincade PW. Constitutively active beta-catenin promotes expansion of multipotent hematopoietic progenitors in culture. J Immunol. 2006 Aug 15;177(4):2294-303
3) Purow BW, Haque RM, Noel MW, Su Q, Burdick MJ, Lee J, Sundaresan T, Pastorino S, Park JK, Mikolaenko I, Maric D, Eberhart CG, Fine HA. Expression of Notch-1 and its ligands, Delta-like-1 and Jagged-1, is critical for glioma cell survival and proliferation. Cancer Res. 2005 Mar 15;65(6):2353-63.
4) Gurdon JB, Byrne JA, Simonsson S. Nuclear reprogramming and stem cell creation. Proc Natl Acad Sci U S A. 2003 Sep 30;100 Suppl 1:11819-22.
Tuesday, April 3, 2007
Cancer cells doing a Dolly: Rise of the cancer stem cells
One of the techniques employed to clone Dolly the Sheep from a differentiated cell is the use of the serum starvation technique. Serum starvation resulted in cells being starved of nutrients, which subsequently leads them to being arrested in the Go phase of the cell cycle that allows re-programming to take place (National Institute of Health). The milieu within a tumor is also similar, whereby nutrients is scarce.
After the step of cell cycle arrest, the nucleus is then introduced into an oocyte to allow nuclear reprogramming to take place. Scientists believe that the cytoplasm of oocytes contain proteins that encourage embryonic development. The notch, wnt and hedgehog pathways have stemness properties, yet they are also implicated in cancer. Aberrant activation of notch signaling has been implicated in human breast cancers (Stylianou et al, 2006). Wnt signaling has also been implicated in colorectal cancer (Bienz and Clevers, 2000). The hedgehog pathway has also been implicated in prostate cancer (Sheng et al, 2004). Exposure to the conditions of nutrient starvation resulting in cell cycle arrest and in addition to the pathways resulting in stemness characteristics such as the notch, Wnt and hedgehog, nuclear reprogramming can take place and we are looking at a fertile ground for the creation of the cancer stem cell through the evolutionary process (de Lau and Clevers, 2001).
Corrections: Added the words "through the evolutionary process" in the last sentence of the last paragraph.
Citations
1) National Institute of Health. http://science.education.nih.gov/home2.nsf/Educational+ResourcesTopicsGenetics/BC5086E34E4DBA0085256CCD006F01CB
2) Starve a Tumor, or Feed a Tumor? http://www.urmc.rochester.edu/pr/News/story.cfm?id=375
3) Stylianou S, Clarke RB, Brennan K. Aberrant activation of notch signaling in human breast cancer. Cancer Res. 2006 Feb 1;66(3):1517-25.
4) Bienz M, Clevers H. Linking colorectal cancer to Wnt signaling. Cell. 2000 Oct 13;103(2):311-20.
5) Sheng T, Li C, Zhang X, Chi S, He N, Chen K, McCormick F, Gatalica Z, Xie J. Activation of the hedgehog pathway in advanced prostate cancer. Mol Cancer. 2004 Oct 13;3:29.
6) de Lau W, Clevers H. LEF1 turns over a new leaf. Nat Genet. 2001 May;28(1):3-4.
Epigenetic control of virus genes during the latent phase
The influenza flu virus has always been an enigma. The virus is able to stay dormant for decades only to re-emerge later. It was suggested that the re-activation of a long dormant infection was a possibility except that the latent phase of the virus has not been found (CDC). It has also been suggested that the influenza virus could lie dormant in humans as opposed to birds and swine (Reid and Taubenberger, 2003, Hillman, 2002). The fact is that influenza virus is a lytic virus and it has no capacity to establish latency.
I would like to suggest a possibility that the influenza A virus could lie dormant if epigenetics factors come into the picture. Chromatin dynamics may come into play as the chromatin structure may regulate the expression of the virus genes. The association of the ORF 62 and 63 (Open Reading Frame) of the Varicella zoster virus with histones (Gary et al, 2006) and the epigenetic regulation of Epstein Barr virus genome by CpG methylation at promoter sites (Takacs et al, 2001) suggests a possibility that an intrinsically lytic virus can be in the dormant state pending on epigenetic factors and chromatin dynamics (heterochromatin VS euchromatin). At this stage, epigenetic and chromatin dynamics control of viral gene expression is merely a suggested possibility on my part.
Citations
1) Center for Disease Control http://www.cdc.gov/ncidod/EID/vol12no01/05-1254.htm
2) Reid AH, Taubenberger JK. The origin of the 1918 pandemic influenza virus: a continuing enigma. J Gen Virol. 2003 Sep;84(Pt 9):2285-92.
3) Hilleman MR. Realities and enigmas of human viral influenza: pathogenesis, epidemiology and control. Vaccine. 2002 Aug 19;20(25-26):3068-87.
4) Gary L, Gilden DH, Cohrs RJ. Epigenetic regulation of varicella-zoster virus open reading frames 62 and 63 in latently infected human trigeminal ganglia. J Virol. 2006 May;80(10):4921-6.
5) Takacs M, Salamon D, Myohanen S, Li H, Segesdi J, Ujvari D, Uhlig J, Niller HH, Wolf H, Berencsi G, Minarovits J. Epigenetics of latent Epstein-Barr virus genomes: high resolution methylation analysis of the bidirectional promoter region of latent membrane protein 1 and 2B genes. Biol Chem. 2001 Apr;382(4):699-705.
Monday, April 2, 2007
The Red Spot method and why we fail in debates
I think this blog article runs late but it comes during the aftermath of the elite Singapore schools' staggering defeat to United World College.
As someone who was brought up in Singapore's education system all the way from primary school to junior college, I became familiar with two words - Red Spot. The words "Red Spot" is a ubiquitous term within our Singapore education landscape. Students typically spend hours practising past year questions from their Red Spot assessment books, all the way from Primary School Leaving Examinations to their GCE "A" levels.
What are the benefits of the Red Spot method then? For one, it reinforces the tag of "exam meritocracy", which Singapore has been associated with. Typically, Singapore students score better than their foreign counterparts in exam-based science quizzes.
However, what are the disadvantages of the Red Spot method? For one, if a student is ingrained into following a rigid framework towards the end of doing well for his National Examinations, he will slowly develop mental inertia. Anything off the beaten track and outside the framework will be frowned upon. I vividly remembered in my college days, I only receive half a mark out of a possible many marks for one question in one of my science subjects. I approached the marker and asked her why I only obtained half a mark. I was told to follow a certain framework in answering questions.
In the thrust and counter-thrust world of debate, the participants can ill-afford to stay within a rigid framework. Any point can have its weakness, and a counter-thrust from the opponent is inevitable. Based on the opponent's counter-thrust, the debater has to develop his next arguement and fire the next salvo. In evolutionary terms, the organism must be able to adapt to changes in the environment to survive. Rigidity, or more accurately, failure to evolve would result in extinction.
Viral therapy for cancer and cancer stem cells
One of the upcoming approaches for the treatment of cancer is the use of the scourge of mankind - the virus. This mode of therapy takes advantage of firstly, the tumor's ability to downregulate immune response and secondly, the virus' ability to specifically target a cell for infection. These genetically-engineered viruses have their pathogenic ability attenuated, but are designed to infect, replicate and lyse tumor cells, and subsequently spread to other tumor cells (Kooby et al, 1999, Suzuki and Curiel, 2001) when the immune response is downregualted by the tumor. Thus, viral therapy offers an interesting alternative to chemotherapy.
However, the issue with cancer treatment by any form of therapy is the problem posed by cancer stem cells, which can metastasize to distant sites and give rise to a heterogeneous population of cells (Kucia et al, 2005). Cancer stem cells have been found in brain cancer, breast cancer and colorectal cancer. As with any other therapy, targeting these cancer stem cells is paramount. With regards to viral infection of stem cells, I have found this intersting paper by Kosugi et al, whereby the investigators used cytomegalovirus to infect stem cells of the central nervous system. Interestingly, the virus-infected stem cells exhibited inhibited growth and DNA replication. As an afterthought, I was wondering if a cytomegalovirus, with its ability to infect stem cells, can be used in the fight against cancer stem cells of the brain cancer. Obviously, some genetic engineering has to be done. The cytomegalovirus is also capable of a lytic phase that can lyse and subsequently infect the other cancer cells (Anders and Punturieri, 1991).
Citations
1) Kooby DA, Carew JF, Halterman MW, Mack JE, Bertino JR, Blumgart LH, Federoff HJ, Fong Y. Oncolytic viral therapy for human colorectal cancer and liver metastases using a multi-mutated herpes simplex virus type-1 (G207). FASEB J. 1999 Aug;13(11):1325-34.
3) Kucia M, Reca R, Miekus K, Wanzeck J, Wojakowski W, Janowska-Wieczorek A, Ratajczak J, Ratajczak MZ. Trafficking of normal stem cells and metastasis of cancer stem cells involve similar mechanisms: pivotal role of the SDF-1-CXCR4 axis. Stem Cells. 2005 Aug;23(7):879-94.
4) Kosugi I, Shinmura Y, Kawasaki H, Arai Y, Li RY, Baba S, Tsutsui Y. Cytomegalovirus infection of the central nervous system stem cells from mouse embryo: a model for developmental brain disorders induced by cytomegalovirus. Lab Invest. 2000 Sep;80(9):1373-83.
5) Anders DG, Punturieri SM. Multicomponent origin of cytomegalovirus lytic-phase DNA replication. J Virol. 1991 Feb;65(2):931-7.
Sunday, April 1, 2007
Normal stem cells and cancer stem cells continued

The oncogenes
Citations:
1) Murphy MJ, Wilson A, Trumpp A. More than just proliferation: Myc function in stem cells. Trends Cell Biol. 2005 Mar;15(3):128-37.
2) Sumi T, Tsuneyoshi N, Nakatsuji N, Suemori H. Apoptosis and differentiation of human embryonic stem cells induced by sustained activation of c-Myc. Oncogene. 2007 Mar 19; [Epub ahead of print]
3) Prendergast GC. Mechanisms of apoptosis by c-Myc. Oncogene. 1999 May 13;18(19):2967-87.
4) Dang CV. c-Myc target genes involved in cell growth, apoptosis, and metabolism. Mol Cell Biol. 1999 Jan;19(1):1-11.
5) Brooks DG, James RM, Patek CE, Williamson J, Arends MJ. Mutant K-ras enhances apoptosis in embryonic stem cells in combination with DNA damage and is associated with increased levels of p19(ARF). Oncogene. 2001 Apr 19;20(17):2144-52.
6) Meletis K, Wirta V, Hede SM, Nister M, Lundeberg J, Frisen J. p53 suppresses the self-renewal of adult neural stem cells. Development. 2006 Jan;133(2):363-9.
7) Lin T, Chao C, Saito S, Mazur SJ, Murphy ME, Appella E, Xu Y. p53 induces differentiation of mouse embryonic stem cells by suppressing Nanog expression. Nat Cell Biol. 2005 Feb;7(2):165-71.
8) Li H, Cao Y, Berndt MC, Funder JW, Liu JP. Molecular interactions between telomerase and the tumor suppressor protein p53 in vitro. Oncogene. 1999 Nov 18;18(48):6785-94.
9) Janzen V, Forkert R, Fleming HE, Saito Y, Waring MT, Dombkowski DM, Cheng T, DePinho RA, Sharpless NE, Scadden DT. Stem-cell ageing modified by the cyclin-dependent kinase inhibitor p16INK4a. Nature. 2006 Sep 28;443(7110):421-6.
The oncogene Myc plays a role in normal hematopoietic stem cells, activating stem cells to self-renew and differentiate (Murphy et al, 2005). c-Myc was also found to induce apoptosis and differentiation of human embryonic stem cells (Sumi et al, 2007). In a normal cell, c-Myc is able to induce apoptosis via Fas and TNF pathways, and is also connected to p19ARF and p53 mediated apoptosis (Prendergast, 1999). A number of other c-Myc targets are associated with cell growth and proliferation, like for instance, cyclin A and cyclin E (Dang, 1999).
The oncogene Ras is able to stimulate cell proliferation via the MAP kinase signalling pathway. However, Ras was also shown to be able to induce apoptosis in embryonic stem cells (Brooks et al, 2001) via the p19(ARF)-p53 route.
The tumor suppressors
The tumor suppressor p53 is able to induce apoptosis in the event of a DNA damage. A function for tumor suppressor p53 in stem cells has been elucidated, and it has been found that p53 is able to suppress self-renewal of adult neural stem cells (Meletis et al, 2006). It was also found that p53 could induce differentiation of mouse embryonic stem cells (Lin et al, 2005). In addition, it was also found that p53 could interact with telomerase in vitro (Li et al, 1999).
The tumor suppressor p16IN4A is a cell cycle inhibitor and it was found to reduce stem cell proliferation in older mice. It was also found that p16INK4A inhibition reduces aging in stem cells (Janzen, 2006).
The tumor suppressor, APC (adenamatous polyposis coli) was shown to be able to regulate embryonic stem cell survival, whereby it was shown that mutations in APC enhanced the survival of embryonic stem cells (Kim et al, 2004).
Telomeres and telomerase
It is known that stem cells do not have sufficient telomerase to prevent telomere shortening (Flores et al, 2006). It has also been suggested that telomerase activity may increase in later stages of carcinogenesis, as opposed to re-activation of the telomerase enzyme (Armanios & Greider, 2005). It was found that tumor suppressor p53 is able to downregulate the transcription of telomerase (Kanaya et al, 2000). It was also found that p53 was able to inhibit telomerase activity (Kusumoto et al, 1999). It was also found that p16INK4A could inhibit telomerase activity (Saito et al, 2004).
Developmental pathways and pathways within stem cells
The Wnt pathway is a developmental pathway, and it was subsequently shown to be involved in the self-renewal of hematopoietic stem cells (Reya et al, 2003). De-regulated Wnt signalling can occur as a result of APC mutations. The hedgehog pathway involving sonic hedgehog is another signalling pathway in stem cells (Bhardwaj et al, 2001). De-regulated hedgehog signaling can occur as a result of the absence of the Su(fu) protein, and somatic loss of functions mutations have also been found for Su(fu) (Sheng et al, 2004). It was also shown that Su(fu) has tumor suppressor properties (Meng et al, 2001).
Shown on my left are a list of possible mutational hits that leads to the transformation of a normal adult stem cell into a cancer stem cell.
Additions: Italicized text addition at the end of the paragraph to the section on Development pathways and pathways within stem cells. Diagram on left modified to add in Su(Fu) protein on Hedgehog pathway regulation.
Citations:
1) Murphy MJ, Wilson A, Trumpp A. More than just proliferation: Myc function in stem cells. Trends Cell Biol. 2005 Mar;15(3):128-37.
2) Sumi T, Tsuneyoshi N, Nakatsuji N, Suemori H. Apoptosis and differentiation of human embryonic stem cells induced by sustained activation of c-Myc. Oncogene. 2007 Mar 19; [Epub ahead of print]
3) Prendergast GC. Mechanisms of apoptosis by c-Myc. Oncogene. 1999 May 13;18(19):2967-87.
4) Dang CV. c-Myc target genes involved in cell growth, apoptosis, and metabolism. Mol Cell Biol. 1999 Jan;19(1):1-11.
5) Brooks DG, James RM, Patek CE, Williamson J, Arends MJ. Mutant K-ras enhances apoptosis in embryonic stem cells in combination with DNA damage and is associated with increased levels of p19(ARF). Oncogene. 2001 Apr 19;20(17):2144-52.
6) Meletis K, Wirta V, Hede SM, Nister M, Lundeberg J, Frisen J. p53 suppresses the self-renewal of adult neural stem cells. Development. 2006 Jan;133(2):363-9.
7) Lin T, Chao C, Saito S, Mazur SJ, Murphy ME, Appella E, Xu Y. p53 induces differentiation of mouse embryonic stem cells by suppressing Nanog expression. Nat Cell Biol. 2005 Feb;7(2):165-71.
8) Li H, Cao Y, Berndt MC, Funder JW, Liu JP. Molecular interactions between telomerase and the tumor suppressor protein p53 in vitro. Oncogene. 1999 Nov 18;18(48):6785-94.
9) Janzen V, Forkert R, Fleming HE, Saito Y, Waring MT, Dombkowski DM, Cheng T, DePinho RA, Sharpless NE, Scadden DT. Stem-cell ageing modified by the cyclin-dependent kinase inhibitor p16INK4a. Nature. 2006 Sep 28;443(7110):421-6.
10) Kim KM, Calabrese P, Tavare S, Shibata D. Enhanced stem cell survival in familial adenomatous polyposis. Am J Pathol. 2004 Apr;164(4):1369-77.
11) Flores I, Benetti R, Blasco MA. Telomerase regulation and stem cell behaviour. Curr Opin Cell Biol. 2006 Jun;18(3):254-60.
12) M. ARMANIOS * AND C.W. GREIDER. Telomerase and Cancer Stem Cells. Cold Spring Harbor Symposia on Quantitative Biology 2005, Symposium 70, Pages 205-208.
13) Kanaya T, Kyo S, Hamada K, Takakura M, Kitagawa Y, Harada H, Inoue M. Adenoviral expression of p53 represses telomerase activity through down-regulation of human telomerase reverse transcriptase transcription. Clin Cancer Res. 2000 Apr;6(4):1239-47.
14) Kusumoto M, Ogawa T, Mizumoto K, Ueno H, Niiyama H, Sato N, Nakamura M, Tanaka M. Adenovirus-mediated p53 gene transduction inhibits telomerase activity independent of its effects on cell cycle arrest and apoptosis in human pancreatic cancer cells. Clin Cancer Res. 1999 Aug;5(8):2140-7.
15) Saito M, Nakagawa K, Hamada K, Hirose S, Harada H, Kohno S, Nagato S, Ohnishi T. Introduction of p16INK4a inhibits telomerase activity through transcriptional suppression of human telomerase reverse transcriptase expression in human gliomas. Int J Oncol. 2004 May;24(5):1213-20.
16) Reya T, Duncan AW, Ailles L, Domen J, Scherer DC, Willert K, Hintz L, Nusse R, Weissman IL. A role for Wnt signalling in self-renewal of haematopoietic stem cells. Nature. 2003 May 22;423(6938):409-14.
17) Bhardwaj G, Murdoch B, Wu D, Baker DP, Williams KP, Chadwick K, Ling LE, Karanu FN, Bhatia M. Sonic hedgehog induces the proliferation of primitive human hematopoietic cells via BMP regulation. Nat Immunol. 2001 Feb;2(2):172-80.
18) Sheng T, Li C, Zhang X, Chi S, He N, Chen K, McCormick F, Gatalica Z, Xie J. Activation of the hedgehog pathway in advanced prostate cancer. Mol Cancer. 2004 Oct 13;3:29.
Subscribe to:
Posts (Atom)
