A humble tavern for all travellers

Strategies in fighting AIDS

2008-11-18T06:08:00.001-08:00

Few days ago, I blogged about how Perez et al made use of zinc finger nucleases as DNA scissors to get rid of the CCR5 allele within the CD4 T cell, which would confer resistance to the HIV virus. Yet another method exists, which allows gene editing to be made to the CCR5 gene. This is achieved using single-stranded oligonucleotides. These single-stranded oligonucleotides were shown to induce site-specific alterations by activation of DNA repair pathways.

Oligonucleotide-based gene editing has been suggested as an approach to correct genes resulting in neuro-muscular disorders (Bertoni, 2005). Other than single stranded DNA oligonucleotides, DNA/RNA hybrid molecules and double stranded DNA molecules of 100 - 1000 base pairs can be used. The use of microinjection technology allow for the introduction of these genome-altering molecules into the stem cell (Davis).

Unlike current therapeutic approach to correct the defective gene, the trick is to make the CCR5 gene defective which is the opposite, and in doing so, generate a population of HIV-resistant CD4 T cells.

Citations
1) Bertoni C. Oligonucleotide-mediated gene editing for neuromuscular disorders. Acta Myol. 2005 Dec;24(3):194-201.

2) David BR. Genome editing - Its promise and limitations for gene therap. At: http://www.pasteur.fr/applications/euroconf/geneandcelltherapy/22_Davis_abstract.pdf

Cure for AIDS

2008-11-15T10:22:00.000-08:00

The successful transplant of bone marrow by Dr Gero Huetter and followed by the patient's showing no signs of HIV infection might provide some insights into the road to eradicating HIV.

In 2002, it was reported that the Great Ormond Street Hospital successfully attempted gene therapy of a 'bubble' child, who is obviously suffering from SCID. Earlier in June this year, Perez et al demonstrated HIV resistance in CD4 T cells by transciently expressing CCR5 zinc finger nuclease to induce genetic disruption of the CCR5, which provides stable and heritable resistance to HIV virus (Perez et al, 2008). CCR5 is known to be a mediator in the entry of a HIV virus to a T cell. Those with a mutation in the CCR5 are known to be resistant to HIV. The CCR5 zinc finger nuclease provides permanent disruption of the CCR5 allele. Advances have also been made in "gene editing" techniques, which uses zinc finger nucleases.

Perhaps, a possible approach to curing AIDS would be to introduce the zinc finger nucleases to bone marrow cells via gene therapy techniques, transciently expressing these nucleases in order to disrupt the CCR5 alleles. Without the functional CCR5, these altered cells which will be transplanted back into the bone marrow would generate new generations of HIV resistant CD4 T cells.

Citations

1) Perez EE, Wang J, Miller JC, Jouvenot Y, Kim KA, Liu O, Wang N, Lee G, Bartsevich VV, Lee YL, Guschin DY, Rupniewski I, Waite AJ, Carpenito C, Carroll RG, Orange JS, Urnov FD, Rebar EJ, Ando D, Gregory PD, Riley JL, Holmes MC, June CH. Establishment of HIV-1 resistance in CD4+ T cells by genome editing using zinc-finger nucleases. Nat Biotechnol. 2008 Jul;26(7):808-16. Epub 2008 Jun 29

Benefits of cooperate charity

2008-10-02T08:03:00.000-07:00

In a bid to promote industrialization, tax benefits, discounted operating costs and freely available land are being dangled as carrots to entice companies. Companies also participate in charity drives, which provide them with a form of tax relief.

From a public policy planning perspective, it might be worthwhile to consider the benefits of attacting the cooperate sector to partake in charity drives or relief programs through tax reliefs and forms of benefits. Thus, the policy planner can identify a particular area which requires monetary resources, and solicit for the participation of various companies. Monetary resources are not required all the time. Even donated office space, land, equipment, stores and other peripherals can be done in the name of charity towards the community.

The companies will naturally benefit from tax relief and other benefits in exchange for their charity. They will also benefit from the positive image the community has of them, which itself is a form of advertorial.

In the past, charity organisations have always borne the mantle of charitable or relief works. Perhaps, the cooperate segments of the society should also be roped as well.

A possible cancer immunotherapy approach - Inducing the formation of granulomas

2008-09-27T06:09:00.000-07:00

Granulomas are formed when the immune system encounters an antigen it cannot destroy, and as a result, it attempts to isolate the antigen, leading to the formation of a granuloma. A granuloma consists of macrophages, immune cells and a extracellular matrix. T cells are the perpetuator of granuloma formation, secreting cytokines and expressing adhesion molecules.

Non-resectable tumours have always posed problems for cancer patients. Standard treatment of non-resectable tumours include radiotherapy and chemotherapy. Perhaps, it is possible if the immune system can be tweaked to form a granuloma around the tumour mass, isolating it from the rest of the body. More work into the cellular processes of granuloma formation will give us an idea of the physiological mechanisms behind it. A greater understanding behind the mechanisms will perhaps allow us to consider this part of our immune process a weapon in the fight against cancer.

Citations
Sacco RE, Jensen RJ, Thoen CO, Sandor M, Weinstock J, Lynch RG, Dailey MO. Cytokine secretion and adhesion molecule expression by granuloma T lymphocytes in Mycobacterium avium infection. Am J Pathol. 1996 Jun;148(6):1935-48.

Alternative approach to tackling cancer: B cell therapy

2008-03-27T18:17:00.000-07:00

The work of Brendjens et al in retrovirally infecting peripheral T cells thereby transforming them into 19z1+ cells (capable of targeting CD19+ Burkitt lymphoma cell line) marked another approach in cancer therapy. This work demonstrates the possibility of genetically engineering large populations of patient T cells with reactivity towards tumour antigens. Some of the challenges to these approach are the long-term survivalability of the genetically engineered T cells, their ability to home in on tumour sites and establishing a tumour-specific immune response.

Another approach will be to harness the potential of B cells. Like what Brendjens et al did with T cells, the B cells can be virally infected and transformed into cells that are capable of expressing the tumour specific antibodies. Biologics have become notably used in the war against cancer, with avastin, an anti-VEGF antibody, making the headlines in recent times. Thus, the ability to produce anti-cancer antibodies, our body's natural biologics seem to be an attractive proposition. What is so attractive about the use of B cell therapy comes from another intrinsic property of B cells - their ability to present antigens, i.e. they are antigen presenting cells. This means that the B cells are able to augment the adaptive arm of immune response, presenting antigens and co-stimulating T cells in order to direct immune response against the cancer cells. Thus, the possible approach maybe to genetically-engineer the B cells and expose them to tumour antigens. Some of the challenges may be similar to that experienced in T cells, i.e. the ability of the populations of B cells to survive in the body.

Citations

1) Brian Becknell & Michael A. Caligiuri. Cancer T cell therapy expands. Nature Medicine 9, 257 - 258 (2003)

2) Brentjens, R. et al. Eradication of systemic B cell tumors by genetically targeted human T lymphocytes co-stimulated by CD80 and interleukin-15. Nat. Med. 9, 279–286 (2003).

3) Maher, J., Brentjens, R.J., Gunset, G., Riviere, I. & Sadelain, M. Human T-lymphocyte cytotoxicity and proliferation directed by a single chimeric TCR /CD28 receptor. Nat. Biotechnol. 20, 70–75 (2002).

Top civil servant versus private sector executive - an argument from the standpoint of competitivieness

2007-11-17T21:46:00.000-08:00

Earlier on, the Singapore government tabled a motion to peg the salaries of ministers and civil servants to that of the private sector. To peg the salaries against earners in the private sector, there must be some basis to show that a civil servant is indeed comparable to someone who is employed in the private sector.

One of the questions that arises is if there is any basis of comparison in the first place. If there is no basis of comparison, the argument for the need to raise salaries of civil servants and ministers by pegging them to the salaries of executives in the private sector is untenable. This is simply because there is little basis for comparison with their counterparts in the private sector.

In fact, in reality, there is little basis of comparison between someone working in the private sector and a civil servant. In the private sector, the raison d'etre for an employee or executive is simply to generate revenue or profits for the firms they are working for. A top executive in a firm is ultimately answerable to the shareholders, in as far as profits are concerned. Thus, more often than not, the worth of an employee or executive for that matter in the private sector is based on his ability to generate revenue. Therefore, his salary is justified by his ability to generate revenue or level of competitiveness, one way or another. (in the context of this article, competitiveness means the ability to generate profits or revenue in the financial sense).

How about a civil servant or even a top grade civil servant for that matter? His raison d'etre is public administration. Barring exceptions of civil servants occupying certain positions in the Economic Development Board or the Ministry of Trade and Industry, majority of civil servants are not in the position to generate revenue, so to speak. It follows that the working philosophy is not competitive in the sense. This can be illustrated with a simple comparative example. A superscale civil servant working at the headquarters of the Education Ministry makes decisions on the education system in Singapore in a public administrative capacity. However, a top executive in an educational provider company would be tasked with steering the company with the goal of generating more profits in mind. There is a world of difference between the two and the nature and aims of their work. It follows that the argument of using the private sector as a basis to justify the revisions in salary is not tenable.

There is another argument from the basis of lost opportunities, i.e. what talents in the civil service would have gained if they worked in the private sector instead. I am not denying that there are people formerly in the civil service who will eventually do well in the private sector, BUT again, to assert that a top executive within a civil service would go on to be a high flyer in the private sector may not sound convincing. The reason is the argument that I highlight earlier. The civil servant may have been brilliant at public administration, but we do not know if he is brilliant at generating revenue. An extrapolation of such a nature would be problematic.

The main thrust of my argument is that if one wants to peg salaries against a benchmark, there must be some basis of comparison with the benchmark. Thus, it is important to compare a civil servant with a someone working in the private sector. If there is no basis of comparison, then it follows that there is no basis for pegging salaries against that certain benchmark.

A critical look at the current electoral system's problem and a possible solution

2007-11-07T10:36:00.000-08:00

Abstract

The current system of elections in Singapore has this unique feature - the Group Representation Constituency (GRC), whose purported existence is to allow minority representation. That aside, parliamentary elections have seen large percentages in walkovers , i.e. in more than 40% of the seats especially in the years after the GRC was introduced . In the event of a walkover, the political party facing a no-contest automatically gains seat (s) in the parliament. Walkovers occur due to the fact that the current opposition could not field that many candidates to contest all the seats. This paper critically examines the current electoral system's ruling of a walkover, and suggests a possible solution.

The problem with the current electoral system's ruling of a walkover is based on the flawed assumption that the party with the default victory has the mandate of the people living in the ward. This may not necessarily be the case. It could be possible that majority of the people in the uncontested ward desire another political party to represent them. Thus, from the representative democrat viewpoint, the current system is problematic since the wishes of the majority in the ward may not be reflected in the outcome of the elections.

Thus, the solution is to subject the entire "uncontested ward" to a vote. The residents will vote on whether they want the uncontested party to represent them in parliament. If it turns out that majority of the residents wants the uncontested party to represent them, the uncontested party candidates will naturally win their parliamentary seats. If it turns out that the majority of the residents do not want the uncontested party to represent them, the party is out of the running. A subsequent poll will be designated for a later date. In this subsequent poll, the uncontested party is excluded from contesting, given the fact that the majority of the residents do not desire their representation in an earlier vote. The seats at the constituency will then be contested by the other remaining parties. Candidates of other political parties who were unsuccessful in their wards may also contest in this subsequent poll.

Introduction

The parliamentary General Elections is held once every five years. On polling day, voters will vote for their desired representatives, who upon winning the contest in the ward, will serve as Members of Parliament. In the 1991 General Elections, the People's Action Party was returned to power on nomination day, as a result of 10 walkovers in 15 GRCs, and 1 walkover in a Single Member Constituency (SMC), gaining a total of 41 seats out of 81 seats. During the 1997 General Elections, the number of seats in some of the GRCs was increased to 5 seats in some and 6 seats in the others. The People's Action Party was returned to power on nomination day as a result of walkovers in 9 out of 15 GRCs, gaining a total of 47 out of 83 seats. During the 2001 General Elections, the People's Action Party was returned to power on nomination day as a result of walkovers in 10 out of 14 GRCs, gaining a total of 55 out of 84 seats. During the 2006 General Elections, the People's Action Party was not returned to power on nomination day, but it had walkover victories in 7 out of 14 GRCs, gaining a total of 37 out of 84 seats (Singapore Elections). Thus, an interesting observation is that most of the walkovers take place in the GRCs. In the current electoral system, the uncontested party automatically gains the seats in parliament. The question arises whether the residents of the walkover ward supports the uncontested party. From the democratic viewpoint, the current electoral system fails to address the voices of residents in the walkover ward as victory is given to the uncontested party by default, with the possibility that the uncontested party never had the residents' support (majority support) in the first place.

What then are the suggested changes to the current system of electoral contest to address the voices of the residents in the uncontested ward? A two-phase electoral contest is suggested herein as a possible solution. The first phase is known as the "Gatekeeping" phase, which ensures that the uncontested party has the mandate of the people living in the ward. In this "gatekeeping" phase, people will vote on whether or not they want the uncontested party to represent them. If the uncontested party has the approval of the majority in the ward, the "gate" is opened for its entry into parliament. However, if majority votes against the uncontested party, then it is out of the running of the elections. A subsequent poll is carried out at a later date involving the other political parties to determine the representatives of the ward. If the other political parties have enough candidates, they can take part in this subsequent poll. Candidates of the other political parties who are unsuccessful in their contested wards during the earlier election may participate in this subsequent poll too.

Discussion

The suggested approach has its strengths and weak points. Touching on the weak points, one of its criticisms will be from the standpoint of proportional representation (Proportional Representation Library). For example, if in a particular ward, 30,000 voters support the uncontested party, and they are likely to vote for the uncontested party at the "Gatekeeper" polls. However, 20,000 voters support a second political party, while 20,000 voters support a third political party. Thus, the end result is that the 30,000 "majority" out of this 70,000 do not "have their voices heard". In the winner-takes-all nature of the "First Past The Post" system, the uncontested party rightly deserves victory since it has the 30,000 majority. If you have 40,000 voters voting against the uncontested party, will it even be democratic to suggest that the uncontested party deserves to represent the entire ward (Ace Project)? In any sense, current polls at every single ward under the current system is based on the majority-wins-all First Past the Post system. The same criticism of proportional representation can be leveled at the current First Past the Post system. The nature of the contest in each ward under the current electoral system is that of majority is the winner-takes-all, and is by no means based on proportional representation.

Another weak point is perhaps the longer than usual polling period in the event that the "Gatekeeper" poll has eliminated the uncontested party. A later date for the poll has to be set aside for the residents of the uncontested ward to determine their representatives. The drawback is that the formation of the parliament is being delayed.

Moving on to the strength of this approach, first and foremost, it addresses the question of whether or not the uncontested party has the mandate of the people in the ward. It goes that if majority of the people do not desire its representation as reflected in the polls, it's only right that the "gate" to its entry into parliament is closed.

Another strength of this approach is that it preserves the fundamental values of meritocracy. Suppose in a situation whereby the other parties encounter mishaps, be it administrative mishaps or otherwise, and a group of individuals or a single individual apply to contest in this ward. It follows that this group of individuals or individual for that matter are applying for the sake of contesting per se, and are not interested in representing the interests of the voters. Will it wise to give this group of individuals or individual a walkover victory? The answer is an obvious no. The "gatekeeper" poll will be able to easily eliminate such individuals from the contest. In essence, candidates who merit the voter's support will be rewarded accordingly and those who do not deserve the support will be eliminated.

Yet another strength of this approach is that it will further encourage more pro-active participation from the political parties in improving the lives of the voters. Under the current system, the uncontested party is automatically given default victory. If the uncontested party has to win the approval of the voters at the "Gatekeeper" polls, it will have greater impetus to be more pro-active in winning the hearts and minds of voters. All the more the voters will benefit.

The thrust of this paper is to critically examine the current drawbacks of electoral contests in the event of a walkover. There is not much literature out there addressing the event of a walkover, especially from the standpoint of the voters' desires in a walkover ward. Although, it is not without its drawbacks, the benefits outweighs the drawbacks. Thus, it will be a positive move from a democratic perspective that the relevant authorities do try to take steps to allow voters in "walkover wards" to decide who should represent them, either through wholesale changes or revision in the current electoral system.

Citations

1) Ace Project. Electing a President using FPTP. accessible at http://www.aceproject.org/ace-en/topics/es/ese/ese01/ese01a/

2) Proportional Representation Library. Mount Holyoke College accessible at http://www.mtholyoke.edu/acad/polit/damy/prlib.htm

3) Singapore Elections Results accessible at http://www.singapore-elections.com/

The craving for a refuge

2007-11-02T11:16:00.000-07:00

I have just made inroads as I contemplated further on the philosophy of LIFE. It was an unusual event that has "enlightened" me.

A ex-classmate cum project mate of mine was a committed Christian. She was into church activities, helps out in bible studies and plays in a church band. I was more or less aware of her beliefs during the days when we worked together on group projects. I graduated before her, but we still keep in contact, but curiously our topic always veer towards Christianity. It's also a curious position for me, because I consider myself a staunch critic of Christianity. I am a self-confessed avid reader of Bertrand Russell and Friedrich Nietzsche, the former who gave an exhaustive explanation why he isn't a Christian and the latter, known for launching a series of philosophical diatribes on Christianity.

Thus, it's inevitable that in one of the conversations that I launched into a rebuttal of Christianity. Admittedly, I also mentioned things to her like why Christianity is the second most disliked religion here. I also spoke of my cheeky pun at a pastor who conducted services at my grandfather's funeral. I actually asked the pastor,"hey, don't you think the use of sheeps as a description in Christianity is little inappropriate, because sheeps will eventually be fleeced and be sent to a slaughterhouse? Okay, I know I stepped outside the boundaries for once. I also told this classmate of mine that I could not really tolerate Christian groups launching agendas against sexual minorities like gays and lesbians. Don't mistake me for a homosexual, I am a straight, but I feel that everyone deserves a breathing space, a right to employment into the Singapore civil service, irregardless of sexual orientation.

Later on, I thought through my experiences philosophically especially why I seem to observe that some people follow their beliefs in a steadfast fashion. A realization soon struck me. Each and everyone of us craves for a refuge. Some refuges are permanent, whilst others are temporary. A non-performing ex-champion seeks refuge in the memories of his past victories as a source of solace for his current defeats. A practising Buddhist seeks refuge in the Buddha, Dharma and Sangha, and like-wise, a Christian seeks refuge in the arms of the Lord. It is inevitable at various times of our lives, we need shelter from the storms we face, and a refuge is a necessity. I for one admittedly seek refuge in my philosophical imagination, a mental getaway from all the strife out there. It's where my mind leaves my body and I float around in some noumenal realm (not in specific reference to Kant's noumenal realm). Thus, it can be said that the craving for a refuge is a primal urge. There is no denying the importance of a refuge, as it not only allows a person to be temporarily free from the storms, it is also a place of recovery for a person, mentally and to a certain, physically (placebo effect).

Perhaps, it is destiny, Christians call it God's will, Muslims refer to it as Allah's will, Buddhists call it Karma, etc, that I met this classmate of mine. And that my meeting and discussions with her gave me important philosophical insights. I am still what I am, just that I learn to appreciate the why my fellow homo sapiens chose to harbor certain beliefs. Religionwise, I am still at the same station as I was, no I am still not a Christian. (Sorry for the anti-climax)

Dollars and sense

2007-10-06T23:35:00.000-07:00

I may have been a little late in my posting regarding this issue, but I simply couldn't hold my horses with my fingers itching to hit the keyboard. Of late, the media was abuzz with a plethora of response to recent changes to the CPF policy. One of the changes is that the CPF minimum sum will be raised gradually from SGD$80,000 to SGD$120,000 in 2013. The other ubiquitous change is the introduction of compulsory annuities. For those who cannot afford to purchase annuities, they may use their minimum sum for the annuity. In addition, the age for CPF withdrawal has been raised from 55 to 65. Of late, the government is finding ways and means to help our senior brethren to seek employment. One could be forgiven for having the impression that the government is making it more difficult for one to withdraw his CPF.

With the mechanics of the CPF changes in place, one also cannot ignore the costs of living. The passing years have seen rises in costs of necessities such as healthcare, transport and utilities. One would dare to make a safe bet that even beyond 2010, the inflation in costs of the aforementioned necessities will continue.

Of late, the government was alarmed by the fact that a number of Singaporeans are uprooting themselves and planting their roots else where. The thrust of this discussion is not so much the social basis and implication for migration, but rather the "dollars and sense" of migration. The rising costs of necessities is already a push factor for many a retiree. A welfare state that takes care of senior citizens or one with a lower cost of living would be more attractive to a retiree. It doesn't come as a surprise that Singaporeans have settled down in neighboring countries like Thailand, Malaysia and China, other than the popular destinations of US, UK and Canada.

Migration is also the key to the lock of the CPF safe. If one renounces his Singapore citizenship and has become the citizen of another country, he will be entitled to withdraw his CPF savings. The choice of withdrawing CPF monies and settling down in a destination with a lower cost of living would seem like an attractive option. I would surmise in the foreseeable future migration figures will sky-rocket despite the recent changes to the CPF policy. This could be a worrying sign for the investment arm of the Singapore government who use the CPF monies for investments.

What was Martin Jol thinking of?

2007-09-28T22:27:00.000-07:00

Beleaguered Tottenham manager Martin Jol claims that only Arsenal come close to matching his record for introducing talented youngsters onto the first-team stage since he took over at White Hart Lane.

Of course Jol, who succeeded Jacques Santini as Spurs manager three years ago, has spent heavily in the transfer market i that time. But he says his biggest kick is watching Tottenham's youngsters into stars.

And he believes that the young players who have taken Arsenal to the top of the Premier League are no better than his own crop of young players, even though Spurs are currently in the bottom three.

Quoted in The Sun, Jol said: “I feel we have more talented players at Tottenham than any other club. Maybe only Arsenal have the same but their approach is different to mine.

“If you were fickle you would say it is the same for both clubs, but it isn’t. It’s totally different.

“Gael Clichy has been playing at Arsenal for years, getting used to his role behind Ashley Cole before he moved on. Then he comes into the team after a couple of years of preparation.

“Cesc Fabregas was there for three or four years. They were all on the bench and came on when things were going well.

“If your team is in a position where you are playing well and then you bring on, for example, Kevin-Prince Boateng or Adel Taarabt, it’s an easy decision to make.

“Sometimes you have to play them no matter what.

"I felt I had to play Gareth Bale because he is a good option. The same goes for Younes Kaboul. Against Middlesbrough I played Michael Dawson, 22, Kaboul, 20, Bale, 18. That is probably the difference with the big clubs.

“Kaboul, Boateng and Bale didn’t play in the Premier League until this season. Hopefully they will develop into very good players.”

Having been criticised for Tottenham's early-season results, which have pushed the tarhget of Champions League football some way into the distance, Jol said defensively: “It’s not always about the scoreboard. It’s about the development of players like Kaboul, Bale and Aaron Lennon.

“It’s been a bad start, but it’s not as bad as it seems. Nothing is as it seems in football.

“I have to combine the results with the development. Even at Arsenal that is not the case.

“I can mention five or six players who chose to come to Tottenham ahead of other clubs.

“When you buy players, especially young players, you’ve got to play them.

“Look at my team and you will see examples of young players getting the right opportunity here.

“If they see Tom Huddlestone, Lennon and Dawson playing, it is a good example for what someone new can achieve.

“How many years will it take them to develop? What are you on about — we finished fifth last year.

“My philosophy is to get players young, get them used to Spurs and the Premier League.”

No doubt Arsene Wenger would query Jol's assertion that Arsenal do not have to combine results with development.

Critics would also point out that while Tottenham do indeed have some talented young players - though many of them such as Bale, Kaboul, Lennon, Dawson and Huddlestone were bought expensively rather than scouted as unknown youngsters and nurtured through the academy - they do not yet play together as a successful team unit, as the league table confirms. That is a key difference between Tottenham and Arsenal at the moment.

Jermain Defoe might also be surprised by Jol's comment that, if you buy young players, you have got to play them - Source: Goal.com accessible at http://www.goal.com/en/Articolo.aspx?ContenutoId=428607

Perhaps, this is one of the more mundane posts, and it is about most guys' favorite topic - soccer. Apparently, I read during the wee hours of the morning that Monsieur Jol of Tottenham Hotspurs had seemingly claimed that Spurs' youngsters are as good as Arsenal's youngsters. I don't know how will Monsieur Wenger reply to Jol's remarks, but I figure Jol's words will be like a red cloth teasing the most bullish of supporters from both the white and red side of North London.

First and foremost, I would like to qualify myself as a neutral fan, who supports good attacking soccer. Maybe, I may sound biased towards Arsenal, but this is justified based on the free flowing football that Arsenal produces week in week out. If I was born earlier, I might have loved the generation of Spurs players spearheaded by the likes of Oswaldo Ardiles in the 1980s.

One of my initial impression of Jol's remarks is that he has to get a grip of things, and be able to segregate his vision from reality. Jol has done a whole world of good during the time he has been in charge, transforming Spurs from a mid-table team to one that finishes within the top 5 of the English Premier League. From the aforementioned excerpts, I believe Jol has a vision of watching his youngsters develop into future stars. However, realistically speaking, the youngsters at Arsenal are operating at a different plateau as compared to the ones at Spurs.

Firstly, Jol has erroneously pointed out that Arsenal bloods her youngsters when things are going well. That is not really true exactly. The Carling Cup has always been the platform used by Wenger to springboard the progress of his youngsters, and he has never shied away from fielding his fledglings against Premier League sides in the Carling Cup, even more during last season's amazing run to the Carling Cup final, when he stuck by his youngsters against the megastars of Chelsea. Even the neutrals were won over by the fact that the Wengerboys played the diamond-studded stars of Chelsea off the park during certain spells of the match. The Wengerboys had a measure of success of their own, claiming scalps against Premier League sides like Liverpool, Tottenham, and just this week, Newcastle.

Secondly, Jol has to realise the crucial factor of success building on success during the development of youngsters. The Arsenal team has successfully qualified for the UEFA Champions league every season. I would argue that participation in the UEFA Champions League will steepen the learning curve of many a youngster, a luxury that Wenger's youngsters enjoy. Indeed, for a youngster to test himself against Europe's elites, his exposure to the brand of soccer played by the other top sides in Europe and in facing world class players will surely broaden his horizon. I believe players like Gael Clichy, Cesc Fabregas, Theo Walcott, etc have been put through a steep learning curve on European nights. The burgeoning maturity of Wenger's youngsters culminated in their run to the UEFA Champions league final in 2005, with Cesc Fabregas stepping ably into Patrick Viera's shoes. This is why I believe that Arsenal's youngsters operate on a different plateau from Spur's youngsters.

Perhaps, Martin Jol needs a bit more time at Spurs in order to see his vision come into fruition. Wenger has been at Arsenal for more than 10 years and the entire club echoes his brand of footballing ethos from the boardroom to the football pitch. Arsenal's senior team, composed of a group of youngsters plays a triangular form of short passing game that is attractive to watch. The reserve team composed of another group of youngsters plays similarly. The youngsters could fit into the game that the senior team plays. The Arsenal forward, Nicklaus Bendtner, gave an apt epitomy of the Arsenal game - it's about passing and moving. This is not true in the case of Spurs whereby Bale, Kaboul, Dawson, Huddlestone and Lennon who have yet to show that they can click as a successful team unit. Wenger also had the support of the Arsenal boardroom, and his influence of "buying a player and moulding him the Arsenal way" is rather infectious. It is quite obvious that Wenger buys and selects players according to the system that he believes in, which is one of the reasons why his youngsters do not have much of a problem fitting into his team.

Another aspect of Wenger is his proven reputation in youth development. The work of Wenger's talent scouts such as Gilles Grimandi cannot be underestimated. George Weah, Thierry Henry, Patrick Viera and now Cesc Fabregas are among the products of Wenger's development. Young footballers cite Wenger as being the magnet behind their desire to move to Emirates.

It appears that Jol needs more time and other ingredients for his remarks to turn into reality.

Spoofed interview with Celine Dion by Weird Al Yankovic

2007-09-25T08:59:00.001-07:00

Weird Al Yankovic is an immensely talented musician, a one of a kind, whom in my honest opinion really owns the domain of song parody. Who would have forgotten his parody song of Michael Jackson's Bad - Fat, or his comical rapping to the tunes of Gangster's Paradise in Amish Paradise?

Notwithstanding his singing talents, he is also known for conducting spoofed interviews in his very own Al TV. Contemporary artistes alike are being projected in an awkward fashion, through their past recorded responses which were superimposed onto Al's hilarious jibes and queries. He claimed a "victim" in Celine Dion. Enjoy his "interview" with Celine Dion.

Changing the template of my blog

2007-09-25T07:16:00.000-07:00

I have just received feedback from my students that my blog looked rather bland. Hence, I adjusted the background of my blog using a downloaded image of the Aurora Borealis (the Northern Lights), a beautiful and captivating natural phenomenon. Hopefully, it gives my blog a more colourful, albeit mystifying feel.

The eldest child is the smartest!

2007-09-24T08:35:00.000-07:00

I found an interesting article in the International Herald Tribune, and it was found that the eldest child score on average three points higher than his/her other siblings in IQ tests. The reason is due to family dynamics rather than biological factors, e.g. changes in gestation processes. I guess the pressure is on the eldest to learn as much as possible about life in general, in order to guide his/her younger siblings. For those who are the eldest, do rejoice over the fact that you may be more intelligent. For those whom are not the eldest, you can always seek the counsel of your eldest sibling! Be comforted that you have your eldest sibling around to hold your hands and guide you through obstacles when you need him/her the most!

Citations

Benedict Carey. Family dynamics, not biology, behind higher IQ. International Herald Tribune accessible at http://www.iht.com/articles/2007/06/21/africa/siblings.php

Life Science queries

2007-09-24T08:31:00.000-07:00

Students in my lessons, feel free to voice whatever queries, thoughts or views you may have during your course. I will try to respond ASAP. Remember no vulgarities, personal attacks, flaming or anything that is detrimental to the discussion.

Cancer, metastasis and the entire business of vesicle trafficking

2007-09-24T07:31:00.000-07:00

Vesicle trafficking plays a part in cellular processes. Vesicles are formed, undergo expansion and completion, and finally participating in lysosomal degradation. Vesicles are involved in this process known as autophagy. Autophagosomes are double-membrane vesicles. In a paper published by Takahashi et al in Nature Cell Biology, it was found that Bif-1 interacts with Beclin-1, and together with ATG-5, is involved in the formation of autophagosomes. Loss of Bif-1 led to abrogation of autophagy, and the arising of spontaneous tumours in mice (Takahashi et al, 2007). It was also found that during the process of carcinogenesis in mice, there was reduced autophagic activity (Schwarze and Seglen, 1985). Indeed, it's interesting to note the part played by vesicle trafficking pathways in tumorigenesis. Vesicle trafficking pathways may play a part in metastasis. Jiang et al has found that the regulation of matrix metalloproteinase-1 activity was achieved by dynamin-mediated endocytosis (Jiang et al, 2001). The study of vesicle trafficking pathways in cancer and metastatic cells will gives us insights into how they actually assist in the latter's functions.

Citations

1) Yoshinori Takahashi, Domenico Coppola, Norimasa Matsushita, Hernani D. Cualing, Mei Sun, Yuya Sato, Chengyu Liang, Jae U. Jung, Jin Q. Cheng, James J. Mul, W. Jack Pledger & Hong-Gang Wang. Bif-1 interacts with Beclin 1 through UVRAG and regulates autophagy and tumorigenesis. Nature Cell Biology, 23 Septemter 2007

2) Schwarze, P. E. & Seglen, P. O. Reduced autophagic activity, improved protein balance and enhanced in vitro survival of hepatocytes isolated from carcinogen-treated rats. Exp. Cell Res. 157, 15–28 (1985)

3) Jiang A, Lehti K, Wang X, Weiss SJ, Keski-Oja J, Pei D. Regulation of membrane-type matrix metalloproteinase 1 activity by dynamin-mediated endocytosis. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):13693-8.

Really stranger than friction

2007-09-17T06:58:00.000-07:00

Read an article in Times about the trial of Krystian Bala, a novelist of a macabre best seller, containing a story of a murder of which he was responsible for three years ago. He murdered a lover of his former wife. Apparently, the murder victim was tortured to death, presumably by asphyxiation and drowning, whereby a noose was tied around his neck and he was being thrown into a river. A similar account of the murder was written in a book published by Bala titled Amok.

Yet, this account of a crime involving a jealous lover was a poignant reminder to me. During my college days, I was mistaken by a jealous fellow as a boyfriend of a female friend who was my orientation group mate. Yes, I treated her as a friend, but no more than that. This guy actually claimed that I looked like a playboy and told a martial arts-trained friend of his to fix me. It happened that this martial arts trained friend of his was also my friend too. It was from the latter that I found out what happened.

Guess when one is in the deeper throes of passion does he lose his rationality.

Citations
Jail for author of ‘a perfect crime’
http://www.timesonline.co.uk/tol/news/world/europe/article2395523.ece

The driving force of morality

2007-09-16T06:05:00.001-07:00

It has been put forth by Creationists that one of the driving force for the existence of a god is the existence and nature of morality. My first response to this line of arguement is to re-examine the driving force of morality, as in why the need for morality arises?

However, let's begin with this important question - What is morality? Referring to the Stanford Encyclopedia of Philosophy, it refers to a code of conduct put forth by a society or a religious group or normatively refer to a code of conduct would be put forward by rational persons under specific conditions.

The agglomeration of individuals in societies can be argued as the driving force for the need for morality. Simply put, in order for society to function and for its members to thrive, there is a need for the latter to abide by a certain code of conduct so that his/her fellow members will benefit or will be free from harm. Take for instance the traffic code of conduct whereby drivers are exhorted to drive safely by keeping within speed limits. Clearly, the safety of the other members of the society is likely to be preserved if such a code of conduct is in place.

The arising of civil societies is seen as the apex in evolution of a society. There is a paradigm shift away from a more individualistic outlook to a more socially conscious perspective in as far as members are concerned. Thus, going by the London School of Economics definition of civil societies, a civil society is one which revolves around shared interests and values, whereby collective action is taken.

In essence, the society is seen as the driving force of morality for the simple reason that morality is seen as the means to the society's end (good).

Citations
1) The Definition of Morality. Stanford Encyclopedia of Philosophy http://plato.stanford.edu/entries/morality-definition/

2) Definition of Civil Society. London School of Economics
http://www.lse.ac.uk/collections/CCS/what_is_civil_society.htm

Concepts in peer to peer computing: A hierarchical model of file distribution in peer to peer networks through designation of sub-hubs

2007-09-07T08:09:00.000-07:00

Abstract

The use of an algorithm to designate sub-hubs within a peer to peer network will help to lessen some of the problems that networks face i.e. excessive traffic within the network leading to situations such as upstream congestion, which results in the deterioration in performance of other softwares that upload information into the Internet. Besides, the sub-hubs will ensure that the file is being distributed throughout the network as the latter will be relatively free from the constraints of congestion. The algorithm is as follows:

1) Status of user node is determined in terms of percentage of file downloaded;
2) Scan the network for other nodes whose download status is of a certain percentage e.g. 10% greater than the user;
3) Generate a distribution curve of the other nodes over this percentage range;
4) Determine the highest frequency of nodes over the range (if the frequency of nodes over the range is determined to be too low, steps 2 to 4 is repeated, but the network is scanned for nodes whose download status range is greater than the current one e.g. 20% > 10%);
5) Designate these nodes as sub-hubs;
6) User will download from these sub-hubs;
7) else (download from any user irregardless of download status with the part of the file in demand)

Introduction

Peer to peer networks are a popular way to transfer files, and is quite likely, they will be here to stay for quite a long time. They are different from the traditional client-server system, adopting a more decentralised mode of file distribution whereby peers act as equal, merging the roles of server and clients. A number of peer to peer software are in popular usage, e.g. Bittorrent, Emule and many others. This is not to say that peer to peer file transfer is free of any problems of its own. The growth in peer to peer traffic results in network congestion. Upstream traffic congestion can occur in circumstances when a particular user within the network is uploading the file to a large number of peers. This results in a large upstream to downstream ratio. This will likely result in congestion in the upstream link. Interestingly, it has also been shown that 60% of all Internet traffic is being driven by peer to peer traffic (Briere and Hurley, 2007).

A hypothetical scenario and the solution

Consider the network in Figure A. One seed (red node) with 100% of the file is being swarmed by downloaders. The seed is swarmed by 2 downloaders (green nodes) with 90% of the file, 3 downloaders with 70% of the file (blue nodes), 4 downloaders with 20% of the file (brown nodes) and 5 downloaders with 10% (magenta nodes) of the file. There is high likelihood that the seed will experience upstream congestion with dire consequences in their respective networks. The aforementioned algorithm serves to reduce the likelihood of congestion through designation of sub-hubs. In figure B, you can see the frequency distribution of the nodes in terms of percentage of file downloaded. In Figure C, you will be able to see what the algorithm does, i.e. to designate sub-hubs in a hierarchical fashion. You will notice that instead of the seed supplying the file to everyone, it will instead supply the file to the 90% completed downloaders, and the latter will supply the file to the 70% completed downloaders, who will supply the file to the 20% completed downloaders, who will lastly supply the file to the 10% completed downloaders. It can be seen in a hierarchical sense, nodes with a certain percentage of file downloaded that are at the lower echelons of the hierarchy will act as sub-hubs, which can relieve upload traffic from the main hub (the seed or those who have nearly completed downloading the file). It should be noted that the nodes can progress through the hierarchy as a greater percentage of file is being downloaded with time.

Discussion

This algorithm, which can be adopted in peer to peer softwares, is suggested as one of the possible solutions to ease some of the problems inherent in networks with heavy peer to peer traffic. However, it is not really known at this point of time the speed of file download relative to the current peer to peer softwares in use. However, prediction is that the speed of download should be comparable vis-a-vis current peer to peer softwares. Firstly, it will be relatively freer from congestion problems as which is the case with current peer to peer software. Secondly, at each step of progression of download, a source of sub-hubs will increase the speed of file download. It has also been pointed out that one of the main concerns on peer to peer networks is that the speed of download slows down towards the end. However, it's still not known whether this algorithm will be able to address this problem. Finally, it can be seen that this algorithm retains the essential features of the mainstream peer to peer software, i.e. users upload and download files simultaneously, whereby they function as downloaders from sub-hubs above them in the hierarchy (in terms of percentage of file completed), whilst they themselves act as uploaders to users below them in the hierarchy.

Citations
Briere, D and Hurley, P. The Bleeding Edge. Networkworld.com

The dream of robotic science

2007-06-26T23:28:00.000-07:00

As time passes, the size of the microchip becomes more and more miniature. Now, they are talking about creating robotic insects. Perhaps, a more exciting field will see the fusion of nanotechnology with robotic technology, where we create robotic micro-organisms. Imagine a robotic immune cell that is intelligent enough to sniff out cancer cells, virus-infected cells and other pathogen and then get rid of them. Alternatively, we can have a robotic friendly "micro-organism" that targets a tumour mass and gets rid of it. Pretty exciting for the field of medical robotics huh? Okay back to work. I have fantasized enough.

The metastatic stem cell/cancer cell - the inspiration for drug delivery?

2007-06-11T08:02:00.001-07:00

Stem cells and metastatic cancer cell-lines have been known to be able to colonize other tissues. Perhaps, this property might be worth considering in drug delivery, especially for biologic agents. It is possible to use one of these cells, and diminish any potential tumorigenic properties at the same time, introduce the gene to produce the biologic agent. The cell will then be able to metastasize to the target organ to produce its therapeutic effect. Okay, this sounds a little crazy. Back to daydream time!

Anticancer peptides

2007-05-26T13:31:00.001-07:00

There is a series of cationic peptides that are capable of altering the electrical environment of the cell, disrupting it physiologically and causing the death of the cell as a result of affecting the pathways within the cells. The mechanisms of these peptides in altering the cell membrane are two fold. The first mechanism can may involve the peptide's interaction with the ion transport proteins of the cell. The second mechanism involves formation of ion channels per se (Kourie and Shorthouse, 2000). These peptides are available in nature and come from exotic creatures such as scorpions to bees and amphibians like frogs. I figure that targeting the electrical environment of cancer cells that result in their death might be one of the strategies in developing therapeutics against cancer.

Citations
Kourie, J.I. & Shorthouse, A.A. Properties of cytotoxic peptide-formed ion channels. Am J Cell Physio 2000 Jun; 278(6): C1063 - 87.

Of fullerenes and viruses

2007-05-11T23:44:00.000-07:00

I chanced upon an article by RSC Publishing on the use of fullerenes conjugated to antibodies in anticancer therapies(RSC publishing, Ashcroft et al, 2006). Fullerenes are hollow buckyballs, which can be used to carry an assortment of anticancer drugs. The investigators made the fullerene more specific to target cancer cells by conjugating it to antibodies that recognize cancer. With anti-cancer viral therapy now in vogue and nanotechnology progressing, it would even be possible to produce a fullerene conjugated with viral coat proteins for specific targeting of cancer cells.

Citation
1) Fullerene promise in anti-cancer therapy accessible at http://www.rsc.org/Publishing/Journals/cb/Volume/2006/8/Fullerene_anticancer_therapy.asp

2) JM Ashcroft, DA Tsyboulski, KB Hartman, TY Zakharian, JW Marks, RB Weisman, MG Rosenblum and LJ Wilson, Chem. Commun., 2006

The cancer killing virus

2007-05-11T22:51:00.000-07:00

In recent years, the use of virus to eradicate cancer have received a certain measure of success. The use of attenuated viruses with reduced virulence have been shown to be efficacious in certain form of cancers. The concept is simple. Allow the virus to reach the tumors, and the former will replicate within the latter, killing it. I have given this topic a long thought and I thought if it would be possible to infect the cancer cells, and then bring in the immune system to deal with the cancer cells, which were our normal cells gone awry, as though they were infected cells. It would be a combination of two hits on the cancer cells, with the viruses killing and lysing them, and the immune cells killing them too. Such recombinant viruses would have to express genes that are able to mobilize the immune system like the Monocyte Chemotactic Protein-1(MCP-1) and Interleukin-12 (IL-12), which can recruit and activate cellular components of our immune system like Natural Killer Cells, CD8 T cells, etc (Allavena et al, 1994). Under these inflammatory conditions, the Treg cells functions which downregulates immune response will be over-written. Thus, the first steps would be to sneak the virus into the tumour mass and infect the tumour cells, and subsequently, the tumour cells would be lysed by the viruses themselves and the chemokines and cytokines expressed by the tumours would recruit the immune system to kill the tumour mass. The immune system is seen something as a clean-up agent, which also wipes out any trace of the virus, which may persist in the body. However, in scenarios where the tumour cells express pro-apoptotic proteins like the FAS ligands in a mechanism known as the FAS counterattack, which induces apoptosis of immune cells, the efficacy of such a using such a recombinant virus might be reduced, and the reliance would be on the virus to replicate and kill off the tumour cells. However, in certain types of cancer like brain tumour and colorectal carcinoma, there is over-expression of the CD155 (Masson et al, 2001). CD155 can ligate the activating receptor of Natural Killer Cells and induce killing by the latter (Castriconi et al, 2004). Such a proposition makes the idea of recruiting our immune system to target the cancer cells' weakness(overexpressing CD 155) attractive.

Citations
1) Allavena P,Bianchi G,Zhou D,van Damme J,Jilek P,Sozzani S,Mantovani A. Induction of natural killer cell migration by monocyte chemotactic protein-1, -2 and -3.Eur J Immunol. 1994 Dec;24(12):3233-6.

2) Mavoungou E. Interactions between natural killer cells, cortisol and prolactin in malaria during pregnancy. Clin Med Res. 2006 Mar;4(1):33-41

3) Masson D, Jarry A, Baury B, Blanchardie P, Laboisse C, Lustenberger P, Denis MG. Overexpression of the CD155 in human colorectal carcinoma. Gut. 2001 Aug;49(2):236-40.

4) Castriconi R, Dondero A, Corrias MV, Lanino E, Pende D, Moretta L, Bottino C, Moretta A. Natural killer cell-mediated killing of freshly isolated neuroblastoma cells: critical role of DNAX accessory molecule-1-poliovirus receptor interaction. Cancer Res. 2004 Dec 15;64(24):9180-4.

Designing the potent cocktail

2007-05-04T23:29:00.000-07:00

Multidrug resistance is a barrier to the treatment of cancer with chemotherapeutic strategies (Gottesman et al, 2002). P-glycoprotein transporters are responsible for the efflux of drugs from the cancer cells. A number of inhibitors have been designed for the multidrug resistance protein, for instance, the MDR-1 P-glycoprotein. These inhibitors will be added into the cocktail containing an arsenal anti-cancer drug to ensure a move effective treatment. However, side effects should be anticipated considering the fact that MDR drug pumps have a physiological role in our livers and kidneys.

Citations
1) Gottesman MM, Fojo T, Bates SE. Multidrug resistance in cancer: role of ATP-dependent transporters. Nat Rev Cancer. 2002 Jan;2(1):48-58.

Using hepatitis virus to fight liver cancer?

2007-05-04T10:54:00.000-07:00

As my title suggests, it's one big irony considering the fact that hepatoma or hepatocellular carcinoma which involves transformation of hepatocytes is a consequence of viral hepatitis. Liver cancer has a high occurance amongst Asians. In recent days, anti-cancer viral therapy offers a great promise in the fight against cancer, which is why I was wondering if we could use an attenuated hepatitis virus to infect and kill the hepatoma cells. The Hepatitis B virus for instance targets hepatocytes. My suggestion was inspired by this experiment on a rat hepatoma cell-line, whereby scientists demonstrated the propagation of the human Heptitis B virus in vitro (Shih et al, 1989).

Citations

Shih CH, Li LS, Roychoudhury S, Ho MH. In vitro propagation of human hepatitis B virus in a rat hepatoma cell line. Proc Natl Acad Sci U S A. 1989 Aug;86(16):6323-7.

An alternative speculation to the origin of Life?

2007-04-28T13:55:00.000-07:00

The endosymbiosis theory postulates that the mitochondria of eukaryotes evolve from an aerobic bacteria. In recent times, the discovery of the Mimivirus was hailed as a missing link between a virus and a bacteria. However, it is also a fact that the Mimivirus possesses a genome of a size that is comparable to the other bacteria. The mimivirus also possesses genes that are involved in nucleotide and amino acid synthesis, which some bacteria lacked. It also possesses an inner lipid membrane. I was speculating on a model of endosymbiosis whereby the ancestral virion particle like the mimvirus enters a prokaryotic cell. This virus may have accumulated mutations resulting in a defect in assembly of viral coat. As it may have coded for genes that may be beneficial to the prokaryote, it forms a symbiotic relationship with the host. It may be possible that the virus is the ancestor of the nucleus in a modern day eukaryotic cell. Like a nucleus, it can take over the role in controlling the cells.

Mimivirus, the hope for medicine?

2007-04-22T03:46:00.000-07:00

The Mimivirus is the largest known virus known to mankind. It has a size of up to 600 nm. Another amazing thing about this virus is that it harbors a level of complexity which brings it closer in relation to our modern cells, with 911 genes (Prescott, 1993) encoding proteins like the amino - acyl tRNA synthetases, DNA polymerases and other metabolic enzymes. The size of its genome is 1.2 megabase (La Scola et al, 2003). Perhaps the size of the Mimivirus virion is large enough to deliver a human minichromosome into the cell. However, the capsid needs to be engineered in such a way that it can bind to receptors of specific cells. Another challenge would be to package the minichromosome into the viral capsid. If the artificial chromosome is going to be the next thing in gene therapy, the search for a nanoparticle that can act as its carrier continues.

Citations
1) Prescott, L. (1993). Microbiology, Wm. C. Brown Publishers

2) La Scola B, Audic S, Robert C, Jungang L, de Lamballerie X, Drancourt M, Birtles R, Claverie JM, Raoult D. A giant virus in amoebae. Science. 2003 Mar 28;299

Study of the effects of trans-acting factors encoded by viruses

2007-04-21T00:07:00.000-07:00

The proteins encoded by viruses can affect the cell in more ways than one. Thus, it would be interesting to study the long term effects of trans-acting factors encoded by the viruses on cells. One approach may be to integrate the virus's genome into that of the cell's like how a normal virus would infect a cell. The problem is that the virus may integrate in a location within genome whereby the integrated viral DNA element may affect the function and expression of neighbouring genes. In the end, our observations may be affected. I was wondering if it is possible to introduce an artifical chromosome with an integrated viral element instead. It would allow us to study the effects of trans-acting elements encoded by the virus on cells' functions and the long term effect on the cell.

New drug delivery methods delivered at delivering artificial chromosomes aimed at gene therapy

2007-04-20T21:30:00.000-07:00

The use of viral vectors in gene therapy has a severe setback - the risk of cancer. Understandably, viruses have potent promoters and if integrated into a region where an oncogene is found, there is a possibility that cancer can arise. The use of artificial chromosome is attractive as it doesn't disrupt the original genome of the cell and is also capable of replicating. However, it's may be too big to be packaged into viral particles. The advantage of having a viral nanoparticle is its target specificity. However, research on nanoparticles is currently ongoing and before long, we may have a nanoparticle large enough, but having the properties of viral protein coats for target specificity in order to deliver the artificial chromosomes into mammalian cells. I think the artificial chromosome is the future direction of gene therapy but "drug" delivery methods have to be worked on.

Citations
1) New cancer case halts US gene therapy trials. http://www.newscientist.com/article.ns?id=dn3271

2) Human minichromosomes. http://bric.postech.ac.kr/science/97now/01_5now/010504c.html

Artificial chromosomes and their promise in research

2007-04-20T21:00:00.000-07:00

Genetics research has come a long way since the discovery of the DNA double helix by Watson and Crick. It's now possible to construct mammalian artificial chromosomes. Ways have been discovered to induce stable gene expression from a mammalian artifical chromosome (Grimes et al, 2001). There have also been improved methods in delivery of artificial chromosomes to mammalian cells (Chen et al, 1997). Indeed, it's a great way to study trans-acting factors being expressed on a long term basis WITHOUT disrupting the original genome in cell-lines.

Citations
1) Grimes BR, Schindelhauer D, McGill NI, Ross A, Ebersole TA, Cooke HJ. Stable gene expression from a mammalian artificial chromosome. EMBO Rep. 2001 Oct;2(10):910-4.

2) Chen M, Compton ST, Coviello VF, Green ED, Ashlock MA. Transient gene expression from yeast artificial chromosome DNA in mammalian cells is enhanced by adenovirus. Nucleic Acids Res. 1997 Nov 1;25(21):4416-8.

The Civil Servant in the Emperor's court

2007-04-14T12:30:00.000-07:00

I was inspired to write this post when I came across this piece of writing on Du Fu the poet on answers.com. http://www.answers.com/topic/du-fu

(born 712, Xiangyang, China — died 770, Hunan) Chinese poet, often considered the greatest of all time. After a traditional Confucian education, he failed the important civil service examinations and consequently spent much of his life wandering, repeatedly attempting to gain court positions, with mixed success. His early poetry, which celebrates the natural world and bemoans the passage of time, garnered him renown. He suffered periods of extreme personal hardship, and as he matured his verse began to express profound compassion for humanity. An expert in all the poetic genres of his day, he is renowned for his superb classicism and skill in prosody, though many of the subtleties of his art do not survive translation.

A renowned poet, yet I found it surprising that his ambition was to be a civil servant in the emperor's courts, hence my musings on the mind of a civil servant in the emperor's court as shown below:

I, as a civil servant in the Emperor's court acknowledge that:

1) The Emperor is the dragon and he is my overlord.

2) I am also subserviant to the empress dowager.

3) The emperor's son will be the next in line to the throne.

4) If I am under a minister, I have to serve him with unquestioning loyalty.

5) I am prepared to be punished for violating any part of the system that was put into place.

6) I have to pass important examinations if I want to be appointed in leadership roles.

7) Scholars who did better than me in the important examinations would be appointed as officials holding positions that are higher than mine.

8) A degree holder will not necessary be appointed to a civil service position.

9) Someone with a higher classification of degree will stand a better chance at appointment in the civil service than me.

10) This examination system is meritocratic.

11) The values of Confucianism in running the country.

Virology and oncology

2007-04-14T11:47:00.000-07:00

It is known that viruses produce potent activators as well as repressors. An example of a potent transactivator is Tat, in the case of HIV viruses. These transactivators are known to increase the expression of viral genes. However, if such activators are integrated in the vicinity of an oncogene like Ras or Myc, there lies a possibility of transformation. Tat itself has a repressive function on p53, a tumor suppressor (Harrod et al, 2003). Thus, investigating the implications of viral activators and repressors on tumorigenesis is an interesting field. Using a viral vector, a gene encoding an oncogene can be joined TOGETHER with the attenuated viral genome (can synthesize activator proteins, but not others like the viral protein coat) to investigate the effects of the virus' activator function on the oncogene's expression. To investigate the effects on tumor suppressor, the gene encoding the tumor suppressor should be joined together with the attenuated viral genome (can synthesize repressor proteins, but not others like the viral protein coat) and homologous recombination with the wild type tumor suppressor within the genome should be carried out. This is to simulate the event in which the virus integrates itself in the vicinity of the tumour suppressor.

Citations

1) Harrod R, Nacsa J, Van Lint C, Hansen J, Karpova T, McNally J, Franchini G. Human immunodeficiency virus type-1 Tat/co-activator acetyltransferase interactions inhibit p53Lys-320 acetylation and p53-responsive transcription. J Biol Chem. 2003 Apr 4;278(14):12310-8.

A "BAD" day for HIV?

2007-04-14T00:02:00.000-07:00

When the HIV virus infects a cell, usually a CD4 T cell, the reverse transcriptase generates the DNA strand from the RNA, which is then integrated into the host cell's genome. In order for the virus to activate transcription of its genes, it must be able to activate transciption in the chromatin context. Tat, a potent trans-activator was shown to associate with p300 and P/CAF in order to activate transcription (Benkirane, 1998). Tat was also shown to bind to a RNA stem loop structure known as TAR, activating HIV gene transcription (Braddock, 1993). I was wondering if a potential mode of viral therapy could take advantage of a predominance of pro-apoptotic factors over anti-apoptotic factors in inducing the cells to undergo apoptosis.

Genetic engineering can allow us to manufacture a mutant HIV virus. This mutant HIV virus should have Bad and Bax downstream of TAR. It can be generated in caspase 9 knockout cells with the help of a helper virus that allows packaging of the recombinant genome. If introduced into a HIV infected cell, the Tat encoded by HIV within the infected cell can transactivate the expression of Bad and Bax, allowing for the predomination of pro-apoptotic factors and leading to the apoptosis of the infected cell (Gavrilescu and Denkers, 2003). A "Bad" day for HIV indeed.

Citations

1) Benkirane M, Chun RF, Xiao H, Ogryzko VV, Howard BH, Nakatani Y, Jeang KT. Activation of integrated provirus requires histone acetyltransferase. p300 and P/CAF are coactivators for HIV-1 Tat. J Biol Chem. 1998 Sep 18;273(38):24898-905.

2) Braddock M, Powell R, Blanchard AD, Kingsman AJ, Kingsman SM. HIV-1 TAR RNA-binding proteins control TAT activation of translation in Xenopus oocytes. FASEB J. 1993 Jan;7(1):214-22.

3) Gavrilescu LC, Denkers EY. Apoptosis and the balance of homeostatic and pathologic responses to protozoan infection. Infect Immun. 2003 Nov;71(11):6109-15.

Zoonotic viruses: The jump from animals to humans and a possible mechanism for RNA editing?

2007-04-11T05:32:00.000-07:00

Zoonosis is any infectious disease that may be transmitted from animals to human. Some may wonder what are the exact mechanisms that made the virus jump from infecting animals to infecting humans.

There are a number of studies directed at elucidating the role of RNA editing of viral genes. It was found that RNA editing at the amber/W site plays a central role in the replication scheme of the Hepatitis Delta Virus (Casey, 2002). RNA editing was also found to have downregulated the cytotoxicity of Ebola (Volchkov, 2001). In fact, RNA editing was proposed to have occurred in the case of HIV, where there are changes in the viral proteins but no changes in the RNA viral genome that is packaged within the viral particles (Berkhout, 2001 and Bourara, 2000). Thus, the question that remains could be if RNA editing in an animal host results in the synthesis of viral proteins and structurally different viral particles that makes the virus capable of being pathogens in humans and a similar RNA editing mechanism in infected humans lead to other humans being infected too?

Citations

1) Casey JL. RNA editing in hepatitis delta virus genotype III requires a branched double-hairpin RNA structure. J Virol. 2002 Aug;76(15):7385-97.

2) Volchkov VE, Volchkova VA, Muhlberger E, Kolesnikova LV, Weik M, Dolnik O, Klenk HD. Recovery of infectious Ebola virus from complementary DNA: RNA editing of the GP gene and viral cytotoxicity. Science. 2001 Mar 9;291(5510):1965-9.

3) Berkhout B, Das AT, Beerens N. HIV-1 RNA editing, hypermutation, and error-prone reverse transcription. Science. 2001 Apr 6;292(5514):7.

4) Bourara K, Litvak S, Araya A. Generation of G-to-A and C-to-U changes in HIV-1 transcripts by RNA editing. Science. 2000 Sep 1;289(5484):1564-6.

Anti-cancer bacteria?

2007-04-09T09:06:00.000-07:00

I came across an interesting article describing the genetic engineering of myxobacterium in producing an anti-tumor compound (Heim). I worked on colorectal cancer, and I thought it will be interesting to be able to genetically engineer bacteria that is capable of colonizing the colon of colorectal cancer patients and produce the anti-tumor compound through fermentation of raw materials. These bacteria can also be engineered to produce anti-cancer biologics. A good example of a useful bacteria would be Lactobacillus casei Shirota strain, which we can find in Yakult.

Administering these genetically engineered bacteria will be as easy as administering Yakult.

Citations

1) Sabina Heim. http://www.ascenion.de/fileadmin/ascenion/Technology_Offers/Oncology/02-00118_TO_Chivosazol.pdf

My exchange with NMP Siew Kum Tong on the NS issue

2007-04-07T21:50:00.000-07:00

Disclaimer: The contents of my post were SOLELY BASED on MY EXPERIENCE. This is NOT to say that a thorough study was done. Lastly, my experiences DO NOT necessarily reflect the realities on the ground in the absence of a thorough study being conducted.

I happened to chance on NMP Siew Kum Tong's blog, and the pertinent issue of NS men was raised. The crux of the issue was based on comments raised on National Service liabilities handicapping male Singaporean's career.

I did have my fair share of job interviews, and as regards to National Service liabilities (reservist), only one raised the issue. Coincidentally, the interviewer was a Caucasian foreigner, the only foreign interviewer I had. The rest of the interviewers for my other jobs were all Singaporeans. However, I would like to qualify that this is only based on my experience and impressions of Singaporeans and foreigners shouldn't be judged on the basis of my post.

I happened to have an interview for a certain job, although I had another dream job in mind. I wasn't particularly keen on this job, but nonetheless, I attended the interview to satisfy my curiosity and also, as a learning experience. The interview went on okay until the end when the Caucasian interviewer questioned me about my National Service committments. I reassured him that if my services were very urgent to the company, there is an avenue for me to seek a deferment. I also told him that I wasn't a key appointment holder in my National Service unit.

Needless to say, I didn't get the job in the end although I landed my dream job. This is NOT TO say that I was discriminated based on National Service liability. It could also be that I wasn't too particularly keen and treated the interview as some sort of excursion trip to open my eyes. Secondly, I landed my dream job.

Speaking of my dream job, my interviewer who was to become my direct superior was a Singaporean lady. We spent most of our interview discussing the company's vision and other things relevant to my job scope. Nothing was raised about National Service issues. At the end of the day, I was thoroughly satisfied as I managed to land my dream job.

The A*STAR scholar cum Financial Analyst

2007-04-07T09:19:00.000-07:00

I had an interesting exchange with Mr Philip Yeo about biomedical researchers equipping themselves with financial know-hows. I would think that is possible. I knew a friend who was a Ph.D. candidate and passed his Chartered Financial Analyst stage 1 and 2 examinations. His story was a little different because he subsequently grew disillusioned with his life in the laboratory and gave up his Ph.D. studies altogether. He told me that he wanted to move on to finance as a career option.

However, I think being a financial analyst is more than just "knowing the know-hows". Looking at balance sheets for the P/E ratios, liquidity numbers or studying stock market activity by looking at level II quotes, past trends, etc, aren't enough. More research has to be done on the stock option, futures, equities, bonds, etc. The typical financial analyst has to be in the know of the events concerning a company. For instance, news on a particular company buying over another company whose products can boost the current technology of the former's products, thereby increasing sales, is valuable. It doesn't come as a surprise that a typical financial analyst working for a top financial firm spends a substantial amount on his image. These typical analysts are also social animals, and having established a wide network of contacts, they are able to make informed decisions on their choice of investments.

To conclude, it's possible to do biomedical science and KNOW HOW to read financial statements. However, being a financial analyst involves more than just reading financial statements. To be a financial analyst, the proverbial scientist has to swap his lab coat for his business suit!

Story of stem cell transformation continues

2007-04-07T07:58:00.000-07:00

I found an interesting paper describing the formation of DNA adducts in quiescent cells arrested for DNA synthesis and the necessity for the cell to enter the cell proliferation stage for DNA synthesis to occur, resulting in the repair of DNA adducts (O'Neill, 2000). However, it is also during this DNA synthesis stage that the DNA adducts are processed into cellular mutations. Thus, cell proliferation results in both repair of potentially mutagenic adducts and the processing of mutations in the remainder of the DNA adducts (Bielas and Heddle, 2000).

It is known that adult stem cells can be quiescent for a number of years. Thus, there lies the possibility that the adult stem cells could be exposed to mutagens or electrophilic agents capable of forming adducts with DNA. A portion of them can be processed into mutations when the adult stem cells start proliferating. It has also been found that oxidative stress can induce hematopoietic stem cells to proliferate (Liu and Finkel, 2006, Ito et al, 2006). The question that remains is when the adult stem cell is exposed to mutagen and stresses to the cell from reactive oxygen species, are we witnessing its transformation?

Citations

1) J. Patrick O'Neill. DNA damage, DNA repair, cell proliferation, and DNA replication: How do gene mutations result? Proc Natl Acad Sci U S A. 2000 October 10; 97(21): 11137–11139.

2) Bielas JH, Heddle JA. Proliferation is necessary for both repair and mutation in transgenic mouse cells. Proc Natl Acad Sci U S A. 2000 Oct 10;97(21):11391-6.

3) Liu J, Finkel T. Stem cell aging: what bleach can teach. Nat Med. 2006 Apr;12(4):383-4.

4) Ito K, Hirao A, Arai F, Takubo K, Matsuoka S, Miyamoto K, Ohmura M, Naka K, Hosokawa K, Ikeda Y, Suda T. Reactive oxygen species act through p38 MAPK to limit the lifespan of hematopoietic stem cells. Nat Med. 2006 Apr;12(4):446-51.

The loose cannons of stemness

2007-04-06T06:00:00.000-07:00

It has been found that during early metastasis in breast cancer, the early disseminated cancer cells in the bone marrow of breast cancer patients have a breast cancer stem cell phenotype (Balic et al, 2006). Another group have found that mesenchymal stem cells can undergo spontaneous transformation after four to five months in culture (Rubio et al, 2005). Thus, it is likely that during early metastasis of breast cancer, transformation of adult stem cells could have occured. Therefore, it can be seen that tumors arising out of stems cells undergoing neoplastic transformation will lead to a poorer prognosis. These cancer stem cells are capable of limitless proliferation and metastasizing to the other parts of the body. I thought that knowing the type of genetic hits and the steps of progression of a normal stem cell to a cancer stem cell will allow researchers to understand the biology behind early metastasis of cancer cells with stem cell properties.

Lastly, it will be interesting to know how adult stem cells respond to factors resulting in genetic insults. Elucidating how the adult stem cells respond to oxidative stress or electrophilic direct-acting and indirect-acting compounds will allow us to evaluate the degree of susceptility of the stem cell to such insults.

Citations
1) Balic M, Lin H, Young L, Hawes D, Giuliano A, McNamara G, Datar RH, Cote RJ. Most early disseminated cancer cells detected in bone marrow of breast cancer patients have a putative breast cancer stem cell phenotype. Clin Cancer Res. 2006 Oct 1;12(19):5615-21.

2) Rubio D, Garcia-Castro J, Martin MC, de la Fuente R, Cigudosa JC, Lloyd AC, Bernad A. Spontaneous human adult stem cell transformation. Cancer Res. 2005 Apr 15;65(8):3035-9.

Mutational hits: The adult stem cell VS the differentiated cell

2007-04-06T01:40:00.000-07:00

Comparing an adult stem cell to a normal differentiated cell, the former has the ability to colonize other tissues and differentiate into different cell types. The hematopoietic stem cells can differentiate into brain cells (neurons, oligodendrocytes and astrocytes), skeletal muscle cells, cardiac muscle cells and liver cells. Brain stem cells can differentiate into blood cells and skeletal muscle cells (National Institute of Health). Thus, bearing in mind that the adult stem cell can colonize different tissues and differentiate into different cell types, it has some form of "innate talent" to be a metastatic cell.

For a differentiated cell to turn cancerous and be capable of metastasis, it has to suffer from mutational hits for tumor suppressors, oncogenes resulting in gain of function, metastatic suppressors resulting in loss of function and inducers of metastasis resulting in gain of function especially in the process of epithelial to mesenchymal transition (Barrallo-Gimeno and Nieto, 2005).

In recent times, it is possible to culture stem cells in vitro with the various stem cell media available (Biocompare, Nature Protocols). I was thinking of a possible experiment, whereby the adult stem cells are firstly cultured and then exposed to mutagens that are capable of inducing mutational hits on its genome. This is to study the transformation of normal adult stem cells in vitro, which gives us an idea of a sequence of events involving the type of genetic insults experienced by the adult stem cells, giving rise to metastatic cancer cells with stem cell properties, which are capable of colonizing other parts of the body and giving rise to a hetergeneous population of cells.

Corrections: Added italicized words in last sentence of the paragraph

Citations

1) National Institute of Health. http://stemcells.nih.gov/info/basics/basics4.asp

2) Barrallo-Gimeno A, Nieto MA. The Snail genes as inducers of cell movement and survival: implications in development and cancer. Development. 2005 Jul;132(14):3151-61.

3) Stem Cell Media: Biocompare Buyer's guide. http://www.biocompare.com/jump/2463/Stem-Cell-Media.html

4) Neural stem cell culture. Nature Protocols. http://www.natureprotocols.com/2006/08/25/neural_stem_cell_culture_neuro.php

Answers to enrichment exercise

2007-04-06T00:13:00.000-07:00

The answer is Gene 4.

Genes for Life Science teaching

2007-04-05T22:30:00.000-07:00

Gene 1:

1 atgggaggac acaatctagt cttgattatc ttttcggtat ttttgttatc ttcctcagca
61 tatgcaagta gagtcgcaca gtttttagct cctggtgact ttgatgtgac aagtccgaaa
121 tatggtggga agcctaatac tgatattagt cagcctttgg caaatgcttg gaaagatgct
181 tgtgcagcaa caacgccaag tagagttatt gttccaaaag ggacatttca actaaaagga
241 gcagttttca aaggtccttg taaggctcct attacggttc aggttgatgg catactgcag
301 gcgccaccaa ttgaagccca attagcaaat aaagaatttt gggtgcagtt tttagaggtt
361 gagaggctca ctgtatcagg tactggaaca tttgatggtc aaggacaaaa ttcttggaaa
421 gacaacgact gcaataaaaa tccaaactgt ggaggtctag ccattaatgt gagattcgac
481 ttcgagaaaa tcacaatgaa taatgttgct aacccagtcc tcattgacca agaatactgc
541 ccatggggtc agtgtaataa acagattcca tcaaaagtca agatcagcaa tgtgagcttc
601 aagaacatta tagggacaac ttcaactgcg gaggctttga agattgtatg cgctaaaggc
661 ttgcattgtg atcaagtggt actgagtgac atagatctca agttaagtgg caaaggaact
721 cttacatctc attgtgcaaa cgtgcaaccc acgattactc gagtgccacc gcctcttgct
781 tgtgctacca aggcttgatc atattgatta gcagctagaa ataatatgga tctaaaagac
841 tttaggtgtc acgtcaaaaa aaaaaaaaaa aaaaaaaaa

Gene 2:

1 atgggaggac acaatctagt cttgattatc ttttcggtat ttttgttatc ttcctcagca
61 tatgcaagta gagtcgcaca gtttttagct cctggtgact ttgatgtgac aagtccgaaa
121 tatggtggga agcctaatac tgatattagt cagcctttgg caaatgcttg gaaagatgct
181 tgtgcagcaa caacgccaag tagagttatt gttccaaaag ggacatttca actaaaagga
241 gcagttttca aaggtccttg taaggctcct attacggttc aggttgatgg catactgcag
301 gcgccaccaa ttgaagccca attagcaaat aaagaatttt gggtgcagtt tttagaggtt
361 gagaggctca ctgtatcagg tactggaaca tttgatggtc aaggacaaaa ttcttggaaa
421 gacaacgact gcaataaaaa tccaaactgt ggaggtctag ccattaatgt gagattcgac
481 tggtgtccca ttaccctcgt ctgtgtcctt taccaccggc tatggcggtt tcccggctta
541 cagctttggg cctggtgcca acgttggccg cccagccagg accctcatcc caccgacctt
601 cttcagggat ttcgccattg gtgtggcggt gaagcccaat agcgcccaag ggggcgtgct
661 cttcgctatt accgatgctt tccagaaagt catctacctg ggcctgcggc tttcaagtgt
721 ggaggatggg cgccagcggg ttatcctcta ctacacggaa ccaggctccc acgtgtcccg
781 tgaagctgcg gttttctccg tgcccgtgat gaccaacagg tggaatcgtt ttgctgtgac
841 cgtccagggc gaagaagttg ctcttttcat ggactgtgag gaacagagcc aagtccgttt
901 ccagcgatcg tcctggcctt tgacctttga gcccagtgcc gggatctttg tgggcaatgc
961 tggagctatg gggctggaga gatttacggg ttccatacaa cagcttacca tctattcaga
1021 ccccaggacc cctgaggagc tgtgtgaagc acaagagtcc tcggcgtctg gagaagccag
1081 tgggtttcag gagatggatg aagtcgctga aatcatggaa gctgtcacct acacacaagc
1141 cccgcctaaa gaatcacacg ttgatcccat aagcgtgccc cctacttcat cctctcctgc
1201 cgaggactcg gagctttctg gtgagccggt accagaagga accccagaaa cgaacttgag

Gene 3:

1 atgggaggac acaatctagt cttgattatc ttttcggtat ttttgttatc ttcctcagca
61 tatgcaagta gagtcgcaca gtttttagct cctggtgact ttgatgtgac aagtccgaaa
121 tatggtggga agcctaatac tgatattagt cagcctttgg caaatgcttg gaaagatgct
181 tgtgcagcaa caacgccaag tagagttatt gttccaaaag ggacatttca actaaaagga
241 gcagttttca aaggtccttg taaggctcct attacggttc aggttgatgg catactgcag
301 gcgccaccaa ttgaagccca attagcaaat aaagaatttt gggtgcagtt tttagaggtt
361 gagaggctca ctgtatcagg tactggaaca tttgatggtc aaggacaaaa ttcttggaaa
421 gacaacgact gcaataaaaa tccaaactgt ggaggtctag ccattaatgt gagattcgac
481 tgaagctttt ctctctgaga atgcgggggc tgtttttaac cagtttcaga aggtctcaga
541 aggtttggga tcaggagaca aggtcctggc tcttgcaagt attgaagtgg aaaatacaag
601 aaaatgaagc actgtttgaa acaaagtgaa tactttgctg agtattttgt tgaatttggc
661 tgcagatgta tctgttttgt attaatataa ccaagttcta ggtctttcat taacttttat
721 gaaaagactt ttgcatacga tgagcctttg tagcattttt ttttttatct tggcttcatt
781 cacatttgat gataatgatg acagttttgc ggtactttac tttctaaatg tactgcattt
841 tgaaatatat gtacaaataa taaggtattg ttttgaattt ttaataaatt ggttagattt
901 tgttttagtc attttacttt tttgggtcaa gcaggaatca gtgtaatatt atccctgaca
961 agatttatta gatggcagct atactgctac aaatttggca ttctggggaa agaaagaatc
1021 atccccagga ctagggataa cattccagtg gtatttaaaa agacactggc aatttttttt
1081 tttacacccc aatgtttcca ttgactttga cagggaagat tttcaaactg ctgccacact
1141 tacagctttg aagctccacc cccccccccc caaacttgaa taacataatc atggggtcac
1201 cacgaatgaa acagtgacat ttgttggatg acccaaagtg ggaggggcca acaacaggca
1261 atcaagtttc accagttgac tttaaagggg gaaattcaaa ctgctgccaa tctaacagct
1321 ttgaggctac actcgctgaa cttgaatcac atagtcatgg ggtcagactg aatgaaaata
1381 tgattgttgg atgctgaatc ggattttacc tatttacttg gtgaaaattc aacctgctgc

Gene 4:

1 atgggaggac acaatctagt cttgattatc ttttcggtat ttttgttatc ttcctcagca
61 tatgcaagta gagtcgcaca gtttttagct cctggtgact ttgatgtgac aagtccgaaa
121 tatggtggga agcctaatac tgatattagt cagcctttgg caaatgcttg gaaagatgct
181 tgtgcagcaa caacgccaag tagagttatt gttccaaaag ggacatttca actaaaagga
241 gcagttttca aaggtccttg taaggctcct attacggttc aggttgatgg catactgcag
301 gcgccaccaa ttgaagccca attagcaaat aaagaatttt gggtgcagtt tttagaggtt
361 gagaggctca ctgtatcagg tactggaaca tttgatggtc aaggacaaaa ttcttggaaa
421 gacaacgact gcaataaaaa tccaaactgt ggaggtctag ccattaatgt gagattcgac
481 agagtgaaaa attcattagt aagggatgtg acatcactta acagcaaaaa tttccacttc
541 aatattttag ggtgtgaaca tcttacattc caacatgtca tcgtcaaagc accgggagat
601 agccctaaca cagatggaat acatatgggg cgctcaacca ggattaacat tacggacacg
661 aacatcggaa ccggagacga ttgcatatca gttggtgatg gtaccagaca actaactgta
721 agtaaggtaa gttgtggacc aggtcatgga ataagtatcg gaagtctcgg aagatacgac
781 aatgaagatg acgtcagtgg actcaatatt agagattgta ccctgagtaa tacactgaat
841 ggtgttagaa tcaagacatt tcctgcttct cctaaagcta ccaccgcctc ggatattcac
901 ttcgagaaaa tcacaatgaa taatgttgct aacccagtcc tcattgacca agaatactgc
961 ccatggggtc agtgtaataa acagattcca tcaaaagtca agatcagcaa tgtgagcttc
1021 aagaacatta tagggacaac ttcaactgcg gaggctttga agattgtatg cgctaaaggc
1081 ttgcattgtg atcaagtggt actgagtgac atagatctca agttaagtgg caaaggaact
1141 cttacatctc attgtgcaaa cgtgcaaccc acgattactc gagtgccacc gcctcttgct
1201 tgtgctacca aggcttgatc atattgatta gcagctagaa ataatatgga tctaaaagac
1261 tttaggtgtc acgtcaaaaa aaaaaaaaaa aaaaaaaaa

Teaching materials (For Life Science students only)

2007-04-05T12:47:00.000-07:00

Partial sequence obtained after sequencing of strawberry DNA:

ccattaatgtgagattcgacagagtgaaaaattcattagtaagggatgtgacatcacttaacagcaaaaatttccacttcaatattttag ggtgtgaacatcttacattccaacatgtcatcgtcaaagcaccgggagatagccctaacacagatggaatacatatggggcgctcaacca ggattaacattacggacacgaacatcggaaccggagacgattgcatatcagttggtgatggtaccagacaactaactgtaagtaaggtaa gttgtggaccaggtcatggaataagtatcggaagtctcggaagatacgacaatgaagatgacgtcagtggactcaatattagagattgta ccctgagtaatacactgaatggtgttagaatcaagacatttcctgcttctcctaaagctaccaccgcctcggatattcac

My thoughts on the evolution of a differentiated tumor cell to cancer stem cell

2007-04-05T09:21:00.000-07:00

In an earlier comment on my blog, I mentioned about how the "Dolly effect" may possibly result in the generation of cancer stem cells. In the milieu within a tumor mass, an evolutionary fight for survival is being waged. Tumor cells are described according to their grade. Lower grade tumors (grade 1 and grade 2) are more differentiated vis-a-vis higher grade tumors (National Cancer Institute).

It's tempting to suggest an experimental approach in vitro to simulate a sequence of events that may result in the generation of cancer stem cells from differentiated cells. The scarcity of nutrients within a rapidly growing tumor mass makes the acquisition of the ability to metastasize a selective advantage. Acquiring the cancer stem cell phenotype is a step to attaining the advantage. In my suggested approach, Wnt and notch pathways can be constitutively activated through stable transfection of differentiated tumor cells. Constitutively active beta catenin can be transfected to achieve constitutive Wnt/beta catenin signaling (Baba et al, 2006). Similarly, the constitutively active form of Notch, the Notch Intracellular domain (NICD) can be transfected into cell-lines (Purow et al, 2005).

From this in-vitro study, it can be demonstrated that there is an evolutionary pressure for cancer cells to activate pathways associated with signaling in stem cells, and at the same time, the scarcity of nutrients within a tumor mass causes the cell to be arrested in Go stage of the cell cycle, inducing nuclear reprogramming. The selection pressures lead to the rise of the cancer stem cells (Gurdon et al, 2003).

Citations

1)Tumor grade: Questions and Answers. National Cancer Institute. http://www.cancer.gov/cancertopics/factsheet/Detection/tumor-grade

2) Baba Y, Yokota T, Spits H, Garrett KP, Hayashi S, Kincade PW. Constitutively active beta-catenin promotes expansion of multipotent hematopoietic progenitors in culture. J Immunol. 2006 Aug 15;177(4):2294-303

3) Purow BW, Haque RM, Noel MW, Su Q, Burdick MJ, Lee J, Sundaresan T, Pastorino S, Park JK, Mikolaenko I, Maric D, Eberhart CG, Fine HA. Expression of Notch-1 and its ligands, Delta-like-1 and Jagged-1, is critical for glioma cell survival and proliferation. Cancer Res. 2005 Mar 15;65(6):2353-63.

4) Gurdon JB, Byrne JA, Simonsson S. Nuclear reprogramming and stem cell creation. Proc Natl Acad Sci U S A. 2003 Sep 30;100 Suppl 1:11819-22.

Cancer cells doing a Dolly: Rise of the cancer stem cells

2007-04-03T09:40:00.000-07:00

One of the techniques employed to clone Dolly the Sheep from a differentiated cell is the use of the serum starvation technique. Serum starvation resulted in cells being starved of nutrients, which subsequently leads them to being arrested in the Go phase of the cell cycle that allows re-programming to take place (National Institute of Health). The milieu within a tumor is also similar, whereby nutrients is scarce.

After the step of cell cycle arrest, the nucleus is then introduced into an oocyte to allow nuclear reprogramming to take place. Scientists believe that the cytoplasm of oocytes contain proteins that encourage embryonic development. The notch, wnt and hedgehog pathways have stemness properties, yet they are also implicated in cancer. Aberrant activation of notch signaling has been implicated in human breast cancers (Stylianou et al, 2006). Wnt signaling has also been implicated in colorectal cancer (Bienz and Clevers, 2000). The hedgehog pathway has also been implicated in prostate cancer (Sheng et al, 2004). Exposure to the conditions of nutrient starvation resulting in cell cycle arrest and in addition to the pathways resulting in stemness characteristics such as the notch, Wnt and hedgehog, nuclear reprogramming can take place and we are looking at a fertile ground for the creation of the cancer stem cell through the evolutionary process (de Lau and Clevers, 2001).

Corrections: Added the words "through the evolutionary process" in the last sentence of the last paragraph.

Citations
1) National Institute of Health. http://science.education.nih.gov/home2.nsf/Educational+ResourcesTopicsGenetics/BC5086E34E4DBA0085256CCD006F01CB

2) Starve a Tumor, or Feed a Tumor? http://www.urmc.rochester.edu/pr/News/story.cfm?id=375

3) Stylianou S, Clarke RB, Brennan K. Aberrant activation of notch signaling in human breast cancer. Cancer Res. 2006 Feb 1;66(3):1517-25.

4) Bienz M, Clevers H. Linking colorectal cancer to Wnt signaling. Cell. 2000 Oct 13;103(2):311-20.

5) Sheng T, Li C, Zhang X, Chi S, He N, Chen K, McCormick F, Gatalica Z, Xie J. Activation of the hedgehog pathway in advanced prostate cancer. Mol Cancer. 2004 Oct 13;3:29.

6) de Lau W, Clevers H. LEF1 turns over a new leaf. Nat Genet. 2001 May;28(1):3-4.

Epigenetic control of virus genes during the latent phase

2007-04-03T07:08:00.000-07:00

The influenza flu virus has always been an enigma. The virus is able to stay dormant for decades only to re-emerge later. It was suggested that the re-activation of a long dormant infection was a possibility except that the latent phase of the virus has not been found (CDC). It has also been suggested that the influenza virus could lie dormant in humans as opposed to birds and swine (Reid and Taubenberger, 2003, Hillman, 2002). The fact is that influenza virus is a lytic virus and it has no capacity to establish latency.

I would like to suggest a possibility that the influenza A virus could lie dormant if epigenetics factors come into the picture. Chromatin dynamics may come into play as the chromatin structure may regulate the expression of the virus genes. The association of the ORF 62 and 63 (Open Reading Frame) of the Varicella zoster virus with histones (Gary et al, 2006) and the epigenetic regulation of Epstein Barr virus genome by CpG methylation at promoter sites (Takacs et al, 2001) suggests a possibility that an intrinsically lytic virus can be in the dormant state pending on epigenetic factors and chromatin dynamics (heterochromatin VS euchromatin). At this stage, epigenetic and chromatin dynamics control of viral gene expression is merely a suggested possibility on my part.

Citations

1) Center for Disease Control http://www.cdc.gov/ncidod/EID/vol12no01/05-1254.htm

2) Reid AH, Taubenberger JK. The origin of the 1918 pandemic influenza virus: a continuing enigma. J Gen Virol. 2003 Sep;84(Pt 9):2285-92.

3) Hilleman MR. Realities and enigmas of human viral influenza: pathogenesis, epidemiology and control. Vaccine. 2002 Aug 19;20(25-26):3068-87.

4) Gary L, Gilden DH, Cohrs RJ. Epigenetic regulation of varicella-zoster virus open reading frames 62 and 63 in latently infected human trigeminal ganglia. J Virol. 2006 May;80(10):4921-6.

5) Takacs M, Salamon D, Myohanen S, Li H, Segesdi J, Ujvari D, Uhlig J, Niller HH, Wolf H, Berencsi G, Minarovits J. Epigenetics of latent Epstein-Barr virus genomes: high resolution methylation analysis of the bidirectional promoter region of latent membrane protein 1 and 2B genes. Biol Chem. 2001 Apr;382(4):699-705.

The Red Spot method and why we fail in debates

2007-04-02T10:31:00.000-07:00

I think this blog article runs late but it comes during the aftermath of the elite Singapore schools' staggering defeat to United World College.

As someone who was brought up in Singapore's education system all the way from primary school to junior college, I became familiar with two words - Red Spot. The words "Red Spot" is a ubiquitous term within our Singapore education landscape. Students typically spend hours practising past year questions from their Red Spot assessment books, all the way from Primary School Leaving Examinations to their GCE "A" levels.

What are the benefits of the Red Spot method then? For one, it reinforces the tag of "exam meritocracy", which Singapore has been associated with. Typically, Singapore students score better than their foreign counterparts in exam-based science quizzes.

However, what are the disadvantages of the Red Spot method? For one, if a student is ingrained into following a rigid framework towards the end of doing well for his National Examinations, he will slowly develop mental inertia. Anything off the beaten track and outside the framework will be frowned upon. I vividly remembered in my college days, I only receive half a mark out of a possible many marks for one question in one of my science subjects. I approached the marker and asked her why I only obtained half a mark. I was told to follow a certain framework in answering questions.

In the thrust and counter-thrust world of debate, the participants can ill-afford to stay within a rigid framework. Any point can have its weakness, and a counter-thrust from the opponent is inevitable. Based on the opponent's counter-thrust, the debater has to develop his next arguement and fire the next salvo. In evolutionary terms, the organism must be able to adapt to changes in the environment to survive. Rigidity, or more accurately, failure to evolve would result in extinction.

Viral therapy for cancer and cancer stem cells

2007-04-02T07:52:00.000-07:00

One of the upcoming approaches for the treatment of cancer is the use of the scourge of mankind - the virus. This mode of therapy takes advantage of firstly, the tumor's ability to downregulate immune response and secondly, the virus' ability to specifically target a cell for infection. These genetically-engineered viruses have their pathogenic ability attenuated, but are designed to infect, replicate and lyse tumor cells, and subsequently spread to other tumor cells (Kooby et al, 1999, Suzuki and Curiel, 2001) when the immune response is downregualted by the tumor. Thus, viral therapy offers an interesting alternative to chemotherapy.

However, the issue with cancer treatment by any form of therapy is the problem posed by cancer stem cells, which can metastasize to distant sites and give rise to a heterogeneous population of cells (Kucia et al, 2005). Cancer stem cells have been found in brain cancer, breast cancer and colorectal cancer. As with any other therapy, targeting these cancer stem cells is paramount. With regards to viral infection of stem cells, I have found this intersting paper by Kosugi et al, whereby the investigators used cytomegalovirus to infect stem cells of the central nervous system. Interestingly, the virus-infected stem cells exhibited inhibited growth and DNA replication. As an afterthought, I was wondering if a cytomegalovirus, with its ability to infect stem cells, can be used in the fight against cancer stem cells of the brain cancer. Obviously, some genetic engineering has to be done. The cytomegalovirus is also capable of a lytic phase that can lyse and subsequently infect the other cancer cells (Anders and Punturieri, 1991).

Citations

1) Kooby DA, Carew JF, Halterman MW, Mack JE, Bertino JR, Blumgart LH, Federoff HJ, Fong Y. Oncolytic viral therapy for human colorectal cancer and liver metastases using a multi-mutated herpes simplex virus type-1 (G207). FASEB J. 1999 Aug;13(11):1325-34.

2) Suzuki K, Curiel DT. Viral therapy of cancer. Rev Invest Clin. 2001 Jul-Aug;53(4):346-56.

3) Kucia M, Reca R, Miekus K, Wanzeck J, Wojakowski W, Janowska-Wieczorek A, Ratajczak J, Ratajczak MZ. Trafficking of normal stem cells and metastasis of cancer stem cells involve similar mechanisms: pivotal role of the SDF-1-CXCR4 axis. Stem Cells. 2005 Aug;23(7):879-94.

4) Kosugi I, Shinmura Y, Kawasaki H, Arai Y, Li RY, Baba S, Tsutsui Y. Cytomegalovirus infection of the central nervous system stem cells from mouse embryo: a model for developmental brain disorders induced by cytomegalovirus. Lab Invest. 2000 Sep;80(9):1373-83.

5) Anders DG, Punturieri SM. Multicomponent origin of cytomegalovirus lytic-phase DNA replication. J Virol. 1991 Feb;65(2):931-7.

Normal stem cells and cancer stem cells continued

2007-04-01T08:29:00.000-07:00

The oncogenes

The oncogene Myc plays a role in normal hematopoietic stem cells, activating stem cells to self-renew and differentiate (Murphy et al, 2005). c-Myc was also found to induce apoptosis and differentiation of human embryonic stem cells (Sumi et al, 2007). In a normal cell, c-Myc is able to induce apoptosis via Fas and TNF pathways, and is also connected to p19ARF and p53 mediated apoptosis (Prendergast, 1999). A number of other c-Myc targets are associated with cell growth and proliferation, like for instance, cyclin A and cyclin E (Dang, 1999).

The oncogene Ras is able to stimulate cell proliferation via the MAP kinase signalling pathway. However, Ras was also shown to be able to induce apoptosis in embryonic stem cells (Brooks et al, 2001) via the p19(ARF)-p53 route.

The tumor suppressors

The tumor suppressor p53 is able to induce apoptosis in the event of a DNA damage. A function for tumor suppressor p53 in stem cells has been elucidated, and it has been found that p53 is able to suppress self-renewal of adult neural stem cells (Meletis et al, 2006). It was also found that p53 could induce differentiation of mouse embryonic stem cells (Lin et al, 2005). In addition, it was also found that p53 could interact with telomerase in vitro (Li et al, 1999).

The tumor suppressor p16IN4A is a cell cycle inhibitor and it was found to reduce stem cell proliferation in older mice. It was also found that p16INK4A inhibition reduces aging in stem cells (Janzen, 2006).

The tumor suppressor, APC (adenamatous polyposis coli) was shown to be able to regulate embryonic stem cell survival, whereby it was shown that mutations in APC enhanced the survival of embryonic stem cells (Kim et al, 2004).

Telomeres and telomerase

It is known that stem cells do not have sufficient telomerase to prevent telomere shortening (Flores et al, 2006). It has also been suggested that telomerase activity may increase in later stages of carcinogenesis, as opposed to re-activation of the telomerase enzyme (Armanios & Greider, 2005). It was found that tumor suppressor p53 is able to downregulate the transcription of telomerase (Kanaya et al, 2000). It was also found that p53 was able to inhibit telomerase activity (Kusumoto et al, 1999). It was also found that p16INK4A could inhibit telomerase activity (Saito et al, 2004).

Developmental pathways and pathways within stem cells

The Wnt pathway is a developmental pathway, and it was subsequently shown to be involved in the self-renewal of hematopoietic stem cells (Reya et al, 2003). De-regulated Wnt signalling can occur as a result of APC mutations. The hedgehog pathway involving sonic hedgehog is another signalling pathway in stem cells (Bhardwaj et al, 2001). De-regulated hedgehog signaling can occur as a result of the absence of the Su(fu) protein, and somatic loss of functions mutations have also been found for Su(fu) (Sheng et al, 2004). It was also shown that Su(fu) has tumor suppressor properties (Meng et al, 2001).

Shown on my left are a list of possible mutational hits that leads to the transformation of a normal adult stem cell into a cancer stem cell.

Additions: Italicized text addition at the end of the paragraph to the section on Development pathways and pathways within stem cells. Diagram on left modified to add in Su(Fu) protein on Hedgehog pathway regulation.

Citations:
1) Murphy MJ, Wilson A, Trumpp A. More than just proliferation: Myc function in stem cells. Trends Cell Biol. 2005 Mar;15(3):128-37.

2) Sumi T, Tsuneyoshi N, Nakatsuji N, Suemori H. Apoptosis and differentiation of human embryonic stem cells induced by sustained activation of c-Myc. Oncogene. 2007 Mar 19; [Epub ahead of print]

3) Prendergast GC. Mechanisms of apoptosis by c-Myc. Oncogene. 1999 May 13;18(19):2967-87.

4) Dang CV. c-Myc target genes involved in cell growth, apoptosis, and metabolism. Mol Cell Biol. 1999 Jan;19(1):1-11.

5) Brooks DG, James RM, Patek CE, Williamson J, Arends MJ. Mutant K-ras enhances apoptosis in embryonic stem cells in combination with DNA damage and is associated with increased levels of p19(ARF). Oncogene. 2001 Apr 19;20(17):2144-52.

6) Meletis K, Wirta V, Hede SM, Nister M, Lundeberg J, Frisen J. p53 suppresses the self-renewal of adult neural stem cells. Development. 2006 Jan;133(2):363-9.

7) Lin T, Chao C, Saito S, Mazur SJ, Murphy ME, Appella E, Xu Y. p53 induces differentiation of mouse embryonic stem cells by suppressing Nanog expression. Nat Cell Biol. 2005 Feb;7(2):165-71.

8) Li H, Cao Y, Berndt MC, Funder JW, Liu JP. Molecular interactions between telomerase and the tumor suppressor protein p53 in vitro. Oncogene. 1999 Nov 18;18(48):6785-94.

9) Janzen V, Forkert R, Fleming HE, Saito Y, Waring MT, Dombkowski DM, Cheng T, DePinho RA, Sharpless NE, Scadden DT. Stem-cell ageing modified by the cyclin-dependent kinase inhibitor p16INK4a. Nature. 2006 Sep 28;443(7110):421-6.

10) Kim KM, Calabrese P, Tavare S, Shibata D. Enhanced stem cell survival in familial adenomatous polyposis. Am J Pathol. 2004 Apr;164(4):1369-77.

11) Flores I, Benetti R, Blasco MA. Telomerase regulation and stem cell behaviour. Curr Opin Cell Biol. 2006 Jun;18(3):254-60.

12) M. ARMANIOS * AND C.W. GREIDER. Telomerase and Cancer Stem Cells. Cold Spring Harbor Symposia on Quantitative Biology 2005, Symposium 70, Pages 205-208.

13) Kanaya T, Kyo S, Hamada K, Takakura M, Kitagawa Y, Harada H, Inoue M. Adenoviral expression of p53 represses telomerase activity through down-regulation of human telomerase reverse transcriptase transcription. Clin Cancer Res. 2000 Apr;6(4):1239-47.

14) Kusumoto M, Ogawa T, Mizumoto K, Ueno H, Niiyama H, Sato N, Nakamura M, Tanaka M. Adenovirus-mediated p53 gene transduction inhibits telomerase activity independent of its effects on cell cycle arrest and apoptosis in human pancreatic cancer cells. Clin Cancer Res. 1999 Aug;5(8):2140-7.

15) Saito M, Nakagawa K, Hamada K, Hirose S, Harada H, Kohno S, Nagato S, Ohnishi T. Introduction of p16INK4a inhibits telomerase activity through transcriptional suppression of human telomerase reverse transcriptase expression in human gliomas. Int J Oncol. 2004 May;24(5):1213-20.

16) Reya T, Duncan AW, Ailles L, Domen J, Scherer DC, Willert K, Hintz L, Nusse R, Weissman IL. A role for Wnt signalling in self-renewal of haematopoietic stem cells. Nature. 2003 May 22;423(6938):409-14.

17) Bhardwaj G, Murdoch B, Wu D, Baker DP, Williams KP, Chadwick K, Ling LE, Karanu FN, Bhatia M. Sonic hedgehog induces the proliferation of primitive human hematopoietic cells via BMP regulation. Nat Immunol. 2001 Feb;2(2):172-80.

18) Sheng T, Li C, Zhang X, Chi S, He N, Chen K, McCormick F, Gatalica Z, Xie J. Activation of the hedgehog pathway in advanced prostate cancer. Mol Cancer. 2004 Oct 13;3:29.

19) Meng X, Poon R, Zhang X, Cheah A, Ding Q, Hui CC, Alman B. Suppressor of fused negatively regulates beta-catenin signaling. J Biol Chem. 2001 Oct 26;276(43):40113-9.

MARs probe discover Martian nematode worm

2007-03-31T10:50:00.000-07:00

Source: LeSolara News Agency

The probe that was launched into space and landed on Mars has discovered a Martian fossil. It looked like a nematode worm. Dr William Kandinsky, one of the researchers responsible for the Mars probe design was excited over the findings. He told reporters at a press conference yesterday: "All of us are excited over this discovery. For the first time, we have discovered alien multi-cellular life in the Red Planet. It's possible that more complex lifeforms may exist in the vast expanse of the universe where conditions are suitable for the development of life."

It was rumored that the team responsible for the design of the Mars probe considered designing more advanced probes and sending them to Mars to look in every nook and cranny for signs of complex life. However, Dr William added cautiously,"as much as we want to extensively explore the Red Planet, the reality is that we need funds to proceed, and I would like to appeal for the support of the US President in this endeavour. However, I would urge more calm and restrain as it is only an idea thrown out during the euphoria of the fossil discovery."

For researchers at SETI (Search for Extra Terrestial Intelligence), there was cause for celebration. Dr Alain Armstrong remarked:"The Mars probe has shown to us the first signs of complex life. This has given hope to those who have dedicated their lives to searching for extra terrestial intelligent life."

Even a select group of people, especially those who claimed to be abducted by UFOs felt vindicated by the discovery. We interviewed Mr Joel Ninewater, who has been claiming to be a victim of alien abduction. He claims to have entered a gateway into an alien world whilst hiking through the Amazonian forests. He further claims that the aliens treated him like a laboratory rat, inserting funny objects into his genitals. He vividly remembered one experiment where his head was severed from his body and placed near his foot. Amazingly he survived to tell the tale. When told of the Mars nematode worm, Mr Joel loudly exclaimed:"I am not surprised at this finding! I was fed with worm-like looking stuff when I was a lab rat! I ain't surprised if Mars was of those aliens' labs!"

We approached a prominent biologist, Dr Charles Dawkin, and asked him to give a species name to this nematode worm. Dr Charles politely declined, mentioning as a matter of fact that the honor should go to the discoverers of this nematode worm instead. We proceeded to ask Dr William if he had any species name in mind for this nematode worm. Dr William's immediate reply was that he might need to enrol in additional latin classes before he can even think of a name for this nematode worm since the species name of organisms is in latin most of the time.

If you have read the above article, you would realize that it is a product of my fabrication. Earlier on, the name of my fabricated news agency was called Solara News Agency. I realized that such an agency existed, and have since changed it to LeSolara News Agency in order to avoid misrepresentation. HAPPY APRIL FOOL'S DAY TO ALL!!!!!!!!!

The wonders of cell fusion

2007-03-31T01:59:00.000-07:00

In the past, scientists fuse cells of different types creating a heteokaryon. It used to be that the Sendai virus is a popular tool for cell fusion, although now there are chemical means available. It can be shown that proteins from one fusion partner can affect the gene expression in the other partner's nucleus. There are interesting types of fusion. The fusion of a stem cell with a differentiated cell. The fusion between a metastasizing cell and a non-metastasizing cell. The fusion between a cancer stem cell and a normal stem cell. The fusion between a B cell and a rapidly dividing mammalian cell. The fusion between a mammalian cell and an immortal cell line to allow them to survive in culture. Or in recent debates on Aaron Ng's blog, the fusion of cells from a crane and an amphibian such as a frog or a toad???!!!!!

Citations

1) CELL BIOLOGY: ON MECHANISMS OF CELL-CELL FUSION http://scienceweek.com/2005/sw050520-3.htm

Using cancer stem cells as a model to study differentiation program in normal stem cells

2007-03-30T20:40:00.000-07:00

Pioneering work has been done on cancer stem cells, and it has been found that they could give rise to a heterogeneous population of cells. Cancer stem cells were found on brain tumors, colorectal cancers and breast cancers.

Cancer stem cells are in many ways similar to normal stems cells. Both are capable of self renewal and asymmetric division that gives rise to a heterogeneous population of cells. The only difference is that the former is a rogue agent, and is refractory to inhibitory signals in its surrounding milieu. However, studying the pathways that allows it to give rise to a heterogeneous population of cells is pretty interesting, and may give researchers an idea how to grow a tissue from a normal stem cell, except that this time it's growing normal tissue as oppose to cancerous tissue.

Citations

1) Singh SK, Clarke ID, Terasaki M, Bonn VE, Hawkins C, Squire J, Dirks PB. Identification of a cancer stem cell in human brain tumors. Cancer Res. 2003 Sep 15;63(18):5821-8.

2) Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 2003 Apr 1;100(7):3983-8.

3) O'Brien CA, Pollett A, Gallinger S, Dick JE. A human colon cancer cell capable of initiating tumour growth in immunodeficient mice. Nature. 2007 Jan 4;445(7123):106-10.

The day that is Friday (a poem by me)

2007-03-30T06:32:00.000-07:00

The final lap of the week beckons,
a rejuvenating call to the tired ones,
exhausted from the earlier laps!
Morning begins with a tone of optimism,
everyone teeming with energy,
even the strictest starts practicing leniency.
Afternoon arrives with more fanfare,
long discussions of weekend plans permeate the air,
bachelors plan their brief getaways,
parents contemplate on their next family trip,
kids await in anticipation.
Evening comes with a flourish of activity,
with lifts full during knock-off hours,
voluminous traffic jamming up the freeways,
almost as if a race has begun.
Comes nightfall, a premature start to the weekend!
Pubs, entertainment joints and nightspots,
spark to life during the gallivanting hours.
Time flies during moments of pleasure,
the next week’s beginning lying in the corner,
but we can hopefully look ahead,
keeping next Friday’s arrival in our sights!

Smarter vehicles for drug delivery

2007-03-30T04:04:00.000-07:00

Pharmacology is still a relatively young science. In the good old days of drug development, there would inevitably be side effects for most drugs that we take, as they will act on other tissues and organs, other than the intended targets.

For more specific targeting of the cells, using the virus offers an effective tool. One group managed to develop a liposome-based vector whereby the liposome was decorated with viral envelope fusion proteins (Kaneda, 1998). Developing viral nanoparticles as a vehicle to deliver drugs is also another development in progress.

After all, it's using the scourge of mankind as a delivery vehicle of therapeutic agents to specifically target cells of interest whilst leaving the rest alone. Specific drug delivery will eventually lead to fewer side effects.

Citations

1) Kaneda, Y. Fusigenic sendai-virus liposomes : a novel hybrid type liposome for gene therapy. Gene therapy 1998, vol. 14, no 5, pp. 387-572 (2 p.3/4), pp. 553-572.

2) Virus Nanoparticles Provide Convenient Oral Drug Delivery Vehicle. http://nano.cancer.gov/news_center/nanotech_news_2005-10-10a.asp

Supper time and some possible freebies to come along!!!

2007-03-29T09:25:00.000-07:00

Went to the 24 hours McCafe at East Coast for some supper. I was surprised to see some students mugging. Oh yeah, I forgot, it's revision time for the undergraduate lads at NUS, NTU, SMU, etc. It's the time when final examinations are around the corner.

For bloggers or readers interested in obtaining some sort of bond free funding for postgraduate studies, kindly click on the link here. No strings attached postgraduate scholarship.

A perspective on the perception of scholarship bonds and obligation

2007-03-29T06:25:00.000-07:00

Disclaimer: This blog article has NEITHER to do with the defense of scholarship bond breakers NOR condemnation of the latter. This blog article should be read in the spirit of a perception of a scholarship bond/contract, and the reason(s) affecting it. Lastly, the contents discussed MAY NOT necessarily apply to all bond breakers.

I happened to have an exchange with a civil servant via email and an interesting topic pertaining to the perception of scholarship bonds and obligations cropped up. It was mentioned to effect that some scholars who went to America to pursue their undergraduate studies had a more lenient and sympathetic view of bond-breakers.

First and foremost, America champions itself for being the proponent of capitalism. It doesn't come as a surprise that the highest bidder for human capital would be able to land the services of an employee whose talents are highly sought after. Neither is it surprising that big companies can afford the liquidated damages stipulated within a scholarship contract.

Thus. it can be seen that if one is in a country that is known as a bastion of Capitalism, his perception might change. The typical capitalist believes in an economic system whose production is privately owned, and operated FOR PROFIT. The consequence is that the scholar, with his highly sought after talents might view his scholarship contract as any other contract, and values of obligation to the state (Singapore) is replaced by a "I will only work for the highest bidder" mentality.

I would like to take readers back to an oft-mentioned issue, the pegging of ministerial salaries to the top earners within the private sector. It can be seen that our leaders are aware of the inevitable enroachment of capitalism. At the same time, they feel that they want to retain personels whom they feel are talented. What is their response then? Pegging of salaries to the very best within the private sector.

Our forefathers used to preach the values of altruism for a cause, placing country before self. However, in our modern era, can these such values withstand the onslaught of capitalism?

Using the HIV virus against itself

2007-03-29T04:26:00.000-07:00

The HIV virus is known to be able to dock on the CD4 receptor of CD4 T cells via its GP120, infecting the CD4 T cells in the process.

I doodled out a possible therapeutic strategy, using the HIV virus against itself. Now, RNAi technology is improving, and it's possible to produce permanent cell-lines producing siRNA to knock down genes. Using genetic engineering techniques, siRNA inserts that target HIV virus genes can be designed. By genetic engineering, this therapeutic version of the HIV virus based on the principle of retroviral RNAi can be designed, with the harmful genes deleted.

What happens is that this therapeutic HIV virus is still able to infect CD4 T cells, BUT it can enable the CD4 T cells to knock down the genes of the pathogenic and harmful HIV virus. It can knock down the expression of harmful HIV virus genes in infected CD4 T cells and boost the RNAi defense of uninfected CD4 T cells against the HIV virus. It's a form of retroviral gene therapy cum defense against the pathogenic HIV virus.

Citations

Retroviral RNAi http://www.imgenex.com/rnai_list.php?id=26

University Scholars Program, an admirable initiative in uncertain waters

2007-03-28T05:51:00.000-07:00

Disclaimer: The parts where I mentioned about grade fixated personels' perspectives DO NOT represent my point of views, but rather the point of views of the former.

Allow me a little introduction. The University Scholars Program at the National University of Singapore is a premier undergraduate program designed to develop the intellect, leadership and personal potential of promising students. There is a high degree of academic rigour involved in the courses offered, and there is higher expectations required of a student taking a University Scholars Program module in terms of preparation, homework, assignment and research. The academic requirements of a University Scholars Program module is higher than that of a General Elective module, taken by students outside the University Scholars Program. Quoting the website of the University Scholars Program, it offers a rigorous broad-based multidisciplinary curriculum and exciting local and overseas research and beyond-the-classroom learning opportunities. Students are admitted into the University Scholars Program on the basis of academic results and co-curricular activities records. They also have to write an essay and go through an interview. Thus, it doesn't come as a surprise that top students are admitted into the University Scholars Program.

From my research on graduate school admissions overseas especially the United States, I must qualify that going through the University Scholars Program would be able to put a candidate in an advantageous position. Graduate school admissions committees place a premium on a challenging academic curriculum because this will reflect to them the ability of the candidate to handle graduate school course work. In addition, modules offered by the University Scholars Program diverse as they are have an indepth coverage of the respective discipline or sub-discipline. Thus, I would like to qualify that as far as the University Scholars Program is concerned, it's main benefit is rather catered to those intending to go to graduate schools.

Now, readers may question, what about the "uncertain waters" in my title? The uncertain waters refers to our grade-fixated society. However, I also must qualify that the situation is helped in no part by the bell-curve grading policy adopted by the University Scholars Program in the grading of its modules. It may be attributed to a prevailing Asian mentality that results in a fixation on grades. Indeed, a grade-fixated head hunter did admitted to me that he has a tendency to look for graduates with top honours degrees. Even some sectors within the civil service at entry level require graduates with good degrees, like Monetary Authority of Singapore. For graduates intending to obtain scholarships from agencies like A*STAR, they would need a second upper honors or better. Hence, it may not be that surprising that even students are fixated over grades.

Allow me to touch on the open fact about the University Scholars Program's bell curve grading policy. From the perspective of a student who is fixated over grades, he/she will not relish the prospect of participating in the University Scholars Program. The reason is two-fold. He would be better off taking an ordinary General Education Module, which is nowhere as academically rigorous as a University Scholars Program module, and have more time for his other modules and degree course work. The second reason is that the grade fixated student do not want to risk scoring a poor grade as a result of the bell curve grading policy adopted by the University Scholars Program in a class of top students. Thus, if we take academic demands, time dedicated to the module and bell curve into consideration, for every grade that a grade-fixated student can score for a University Scholars Program module, he can score at least two grades better for an ordinary General Education Module, and he will see no reason why he should participate in the University Scholars Program. Another consideration is that a student can exercise a Satisfactory/Unsatisfactory option on a General Education Module outside his faculty, but a student in the University Scholars Program cannot exercise the Satisfactory/Unsatisfactory option on a University Scholars Program module. A module that is declared Satisfactory/Unsatisfactory will have no bearing on the CAP/GPA.

From my interaction with friends who opted to leave the University Scholars Program, I was told that they made the choice because they did not want to affect their chances of getting a First Class Honors. They are brilliant lads, and I think it's some sort of a waste that they chose to leave the University Scholars Program. And I do know friends who were of First Class honors calibre not being able to obtain a First Class Honors because their CAP/GPA were pulled down by a string of B pluses or B grades obtained for their University Scholars Program modules, when they could have obtained better grades for reading ordinary General Education Modules instead.

In the uncertain waters lies the harsh dose of reality. To the grade-fixated student, there is no comparative advantage in taking part in the University Scholars Program if grades was his end. The only reward for successfully completing the University Scholar Program is a certificate recognizing that one is a University Scholar. However, the sad fact is that for the grade-fixated employer, only the Honors classification matters. I would like to believe that the University Scholars Program would like its graduates to be leaders in their field and in the society. However, the challenges that it faces comes against the backdrop of a grade-fixated society like ours. If, for example, a University Scholar upon graduation obtained a not-so-good Honors degree (because of a few Bs in his University Scholars Program modules) and is passionate about working in the MAS (Monetary Authority Singapore), but does not make the academic requirements of a graduate officer at MAS, I don't see how to expect an alumnus in this case to be a leader if he cannot end up doing something he has the passion for.

An oft aforementioned point in this write-up so far is the use of bell shaped curve as a grading policy by the University Scholars Program. Some grade fixated students will argue that since they are already undergoing a rigorous curriculum, why should they be penalized by virtue of their position on the bell shaped curve? They will not think it's worth the while to spend to much time on a module, and be placed on a Bell curve, ending up with a B, when he could have gotten an A for doing a lot less in an ordinary General Education Module, and get to spend more time for his other modules. There is also the additional arguement by the grade-fixated students that since the University Scholars Program has already siphoned out the top students during the initial application process of essay writing and interviews, why go to the extent of segregating them further in the University Scholars Program modules? Why go so far to separate the A pluses, As, A minuses, B pluses, etc, over a small difference in marks? Since the University Scholars Program has identified the top students, shouldn't they deserve better?

Grade fixation presents a steep challenge to the University Scholars Program, and in the eyes of a grade-fixated student, in order for the University Scholars Program to be attractive, it needs to address the disadvantages that a student in the University Scholars Program faces vis-a-vis a student taking ordinary General Education Modules. If the University Scholars Program wants to address this disadvantage, what are the possible solutions then? There is a possible solution suggested by Lee Chenghao, a commentator on Aaron Ng's blog in his exchange with A*STAR's outgoing chairman Mr Philip Yeo about A*STAR's 3.8 GPA and I will quote it in its entirety,"why not have a system that recognize individual modules have different difficulty and adjust the rates accordingly? Then, the final criteria would be difficulty x GPA. This solution by Lee Chenghao recognizes the difficulty of University Scholars Program modules, and allow the moderation of CAP/GPA. In that way, students in the University Scholars Program on their way to a good honors degree will not lose out to ordinary students taking General Education Modules, which will help the former more in the environment of grade fixation.

I also learn from friends that the University Scholars Program strives to promote its name by participating in joint programs with Ivy League universities and other top universities worldwide. It remains to be seen if the University Scholars Program has conducted outreach to government agencies and scholarship agencies like A*STAR to promote its name, i.e. a University scholar with a CAP of say 4.3-4.4 is equivalent to a non-University Scholar with a CAP of 4.5 or First Class Honors.

That being said, I still believe that the University Scholars Program with its goals and philosophy is vintage seed, BUT the soil conditions is still not suitable as yet.

Antiviral peptides against HIV

2007-03-28T05:11:00.000-07:00

Anti-microbial peptides are an important component of innate immunity. These anti-viral peptides are responsible for disrupting the membrane integrity of the microbes. In the case of viruses, anti-viral peptides can be developed to target the virus envelope protein. Researchers have already found antiviral peptides that can target the West Nile virus envelope protein (Bai et al, 2007). Another group has found that an antiviral peptide that targets a domain of the human T cell leukemia virus envelope glycoprotein (Pinon et al, 2003).

Currently, there are efforts to design antiviral peptides against the HIV envelope. BMS-378806 binds to GP120 and inhibits interaction of the HIV envelope protein with CD4 receptors (Lin et al, 2003). Perhaps, we need an additional arsenal of antiviral peptides to completely disrupt the integrity of the HIV virus envelope.

Citations
1) Bai F, Town T, Pradhan D, Cox J, Ashish, Ledizet M, Anderson JF, Flavell RA, Krueger JK, Koski RA, Fikrig E. Antiviral peptides targeting the west nile virus envelope protein. J Virol. 2007 Feb;81(4):2047-55.

2) Pinon JD, Kelly SM, Price NC, Flanagan JU, Brighty DW. An antiviral peptide targets a coiled-coil domain of the human T-cell leukemia virus envelope glycoprotein. J Virol. 2003 Mar;77(5):3281-90.

3) Lin PF, Blair W, Wang T, Spicer T, Guo Q, Zhou N, Gong YF, Wang HG, Rose R, Yamanaka G, Robinson B, Li CB, Fridell R, Deminie C, Demers G, Yang Z, Zadjura L, Meanwell N, Colonno R. A small molecule HIV-1 inhibitor that targets the HIV-1 envelope and inhibits CD4 receptor binding. Proc Natl Acad Sci U S A. 2003 Sep 16;100(19):11013-8.

Tumor cells and evolution

2007-03-28T02:26:00.000-07:00

This is a radical viewpoint, and I could even be wrong, worse, get lambasted for it. Somewhere along evolutionary time, different types of cells gradually "learnt" how to cooperate together, and function to the needs of the community of cells. When they were required to undergo apoptosis, they underwent apoptosis. When they were detached from the extracellular matrix, they underwent anoikis. When they were required to secrete certain substances, they did so. When cells obeyed the laws of their community, the entire community benefits.

Tumor cells are a different kettle of fish. They are rogue members of the community. Not only are they refractory to inhibitory signals from the community, they grow and multiply with abundance, competing with the rest of the community for nutrients. They are able to detach from the extracellular matrix and metastasize to other organs. Eventually, the being dies from cancer.

From my perspective, ancestor cells were tumor-like in nature. They grew with abundance until nutrient supply became limiting, and probably pressure was on them to coorperate each other. Apoptotic mechanisms could initially be rudimentary, with the apoptotic process improving during evolution (Gordeeva et al, 2004). The next step in evolution will be the development of the cellular policemen - tumor suppressors and metastatic suppressors. Tumor suppressors prevent cells from walking the path of transformation into tumor formation, inducing apoptosis, in the case of p53 inducing apoptosis via BAD, or APC (Adenamatous Polyposis Coli) in the control of the Wnt/beta catenin pathway. In fact, it was even shown that multiple tumor suppressors are able to negatively regulate telomerase (Lin & Elledge, 2003), the enzyme responsible for lengthening telomeres in tumor cell-lines, which confers immortality. Metastatic suppressors play a different function in that they suppress metastasis in tumor cells, preventing them from invading other organs. These cellular policemen are a necessity for a community of cells to aggregate together within a tissue and perform their respective roles, and arrest any "criminal" in sight.

I always thought that every time I look at a cancer cell devoid of control by tumor suppressors and metastatic suppressor, it's like coming face to face with a modern living fossil of an ancestral relic. Cancer cells are known to be hardy and can proliferate independently of the body in culture vessels, just like our microbial counterparts. Ancient cells are hardy, and are known to survive harsh conditions. It's not hard to imagine the tumor-like ancestral cell growing in the primordial soup of cells. However, then again, I could be wrong.

Citations

1) Gordeeva AV, Labas YA, Zvyagilskaya RA. Apoptosis in unicellular organisms: mechanisms and evolution. Biochemistry (Mosc). 2004 Oct;69(10):1055-66.

2) Lin SY, Elledge SJ. Multiple tumor suppressor pathways negatively regulate telomerase. Cell. 2003 Jun 27;113(7):881-9.

DARN phone, woke me up

2007-03-27T11:35:00.000-07:00

Received a phone call in the wee hours of the morning. Couldn't go back to sleep. Replied to some comments by Mr Philip Yeo in this blog. Saw this month's issue of the DISCOVER magazine on the table. Good read. Can tire my eyes and let my imagination run wild in my dreams. That's the inspirational source of my doodles. Good night, ooops good morning everyone! Zzzzzzzzzzzzzzzz

A suggestion for NUS, NTU, SMU, A*STAR and any institutions with a sizeable undergraduate population

2007-03-27T08:44:00.000-07:00

I figure as we speak of a knowledge-based economy, undergraduates should be given a platform to seek knowledge, express their knowledge and hold discussions in their areas of interests.

For instance, if Singapore wants to promote science and technology, it will be good for institutions like NUS, NTU or A*STAR to have an undergraduate science and technology publication. Undergraduates can publish any thing from preliminary findings to little experiments they did behind their supervisors back and even experimental failures in typical format required for submission to a journal, i.e. an abstract, introduction, materials and methods, discussion and citations. Undergraduates can also choose to publish doodled ideas or forecasts within their area of interests in the form of a review or insight article.

The advantages of having such a publication is that it trains undergraduates intending to pursue a career in science in the art of writing a manuscript to be submitted to a journal for publication, an important skill that every scientist should possess. Such an undergraduate publication also allows undergraduates to freely exercise their creativity in order to advance their field of interest. It can also encourage healthy debate amongst undergraduate on an academic subject. For example, undergraduate A submits an earlier publication on why so and so causes cancer. Undergraduate B can critically examine A's publication and write "a critical review of undergraduate B's publication on why so and so causes cancer for his publication.

I was thinking that a blog format can be adopted whereby a publication article after editing can be uploaded, with a comments section by experts in the field. What do you think?

Oil production and economy

2007-03-27T07:44:00.000-07:00

Someone posted a message about oil production, which happened to be an important topic. He highlighted the issue of peak oil production in a comment in my blog, and mentioned that the oil supply might run out during the next few years.

First and foremost, oil is needed for the economy to run. A spike in oil prices will increase the costs of production, which lead ultimately lead to an increase in goods and services. However, from my perspective, the decrease in oil supply may be due to the politics amongst OPEC countries. According to the BBC news report whose link I produce below, Iran and Venezuela are backing oil cuts. Iran is intending to trade oil for EUROs, but I am not sure if it does Singapore any good to be trading oil with Iran in the near future, since we are America's allies. I am not sure whether we have accumulated enough EUROs to purchase oil. Venezuela on the other hand is trading oil for commodities. For example, Venezuela has inked a deal with Cuba for a supply of doctors and paramedics to set up clinics in shanty towns in exchange for oil (thirdworldtraveler.com). Since Venezuela is developing its medical industry, perhaps Singapore should send its over-supply of Life Science graduates to Venezuela to support its medical/biomedical industry in exchange for oil. I don't mind being shipped over to Venezuela. Can ogle at beauties from the land of Miss Universes. Okay, okay, I was kidding on the Life Science part. Don't take me seriously on it.

However, on a serious note, some "bioengineers" have attempted to engineer microbes to produce petroleum products. That may have some impact on the oil industry.

Citations
http://news.bbc.co.uk/2/hi/americas/6258243.stm

http://www.thirdworldtraveler.com/Iraq/Iraq_dollar_vs_euro.html

The minimal cell

2007-03-27T07:04:00.000-07:00

A lecturer once told me that there was an endeavour by scientists to create a minimal cell from scratch by introducing a minimal set of genes. Almost like creating "life" from "dust". I figure wouldn't it be better to knock out gene by gene via homologous recombination and find out the minimal set of genes for survival?

Surprise, surprise Google, and the B cell story continued, with a possible alternative to B cell hybridoma

2007-03-27T04:49:00.000-07:00

I was pleasantly surprised when I typed "lytic phase lysogenic phase", two phases in the "life cycle" of some viruses in the google search engine. Earlier on, I published a blog article titled "A potentially radical new approach to genetic engineering and production of precious proteins". The article in my blog came in 9th out of out of 43,800 pages found. When I typed in "lytic lysogenic phase", my blog article came in 19th out of 45,700. The blog article wasn't so much about virology, but rather harnessing the use of virus to produce precious proteins, and I noticed the rest of the websites were either academic resources or online textbooks about virology. Mine was the only blog amongst them. I understand Google utilizes the PageRank, whereby pages with the most visits will be ranked higher. I was even more surprised becacuse the blog article was published on March 23rd, 2007. I really who were the ones visiting my blog.

I would like to take my suggestion further into the B cells. It's possible to use a similar radical method of genetic engineering technique for B cells. B cells is the most ideal candidate to produce antibodies, but the problem is that one B cell can only produce one type of antibody. Thus, how to get around it? We can call upon our good tiny "friend", the Epstein Barr virus. This Epstein Barr virus is capable of infecting B cells (Wikipedia, Teramoto et al, 2000). The Epstein Barr virus is capable of entering lysogenic and lytic phase (Tsurumi, 1997). It is capable of transforming B cells into B cell lymphomas induced by the Latent Membrane Protein 1 (Specks and Strominger, 1989) and is capable of rapidly growing in in vitro cultures (Smith et al, 1987) during the latent (lysogenic phase) phase. Lytic phase can be induced, and the genes encoding the antibodies can be expressed by genetic engineering of the virus, just like how lytic phase genes can be expressed.

This can lead to the production of precious bodies, but this time, it's using a B cell lymphoma as opposed to a hyridoma.

The original packaged virus can be obtained during the lytic in certain cells be co-infection of a handicapped helper virus.

Citations

1) Teramoto N, Gogolak P, Nagy N, Maeda A, Kvarnung K, Bjorkholm T, Klein E. Epstein-Barr virus-infected B-chronic lymphocyte leukemia cells express the virally encoded nuclear proteins but they do not enter the cell cycle. J Hum Virol. 2000 May-Jun;3(3):125-36.

2) Smith LJ, Braylan RC, Edmundson KB, Nutkis JE, Wakeland EK. In vitro transformation of human B-cell follicular lymphoma cells by Epstein-Barr virus. Cancer Res. 1987 Apr 15;47(8):2062-6.

3) Tsurumi T. Molecular mechanism of lytic phase of Epstein-Barr virus DNA replication. Nippon Rinsho. 1997 Feb;55(2):321-7.

4) Ragoczy T, Heston L, Miller G. The Epstein-Barr virus Rta protein activates lytic cycle genes and can disrupt latency in B lymphocytes. J Virol. 1998 Oct;72(10):7978-84.

5) Speck, S. H. & Strominger, J. L. (1989). Transcription of Epstein–Barr virus in latently infected, growth transformed lymphocytes. In Tumorigenic DNA Viruses: Advances in Viral Oncology, pp. 133-150. Edited by G. Klein. New York: Raven Press.

6) http://en.wikipedia.org/wiki/Epstein-Barr_virus

Shouldn't PSC be following A*STAR's example?

2007-03-26T06:49:00.000-07:00

I find the proportion of PSC scholars from well-to-do families at 53% alarming, compared to A*STAR with a majority of over 70% from HDB homes (Figures as quoted by Mr Philip Yeo).

April 5, 2006
Profile of govt scholarship holders
By Leslie Koh

STUDENTS from better-off families made up about half of government scholarship holders last year. Around one out of two came from families that earn more than $5,000 and live in private homes.

Figures from the Prime Minister's Office show that 53 per cent of Public Service Commission (PSC) scholarship holders came from families earning at least $5,000. This places them in the top one-third of families by income as only 37 per cent of all families in Singapore earned $5,000 or more in 2004.

PM Lee Hsien Loong also said 47 per cent of PSC scholarship holders live in private homes, putting them among the 15 per cent of all families here that can afford more expensive private housing.He gave these figures in a written reply to Nominated MP Tan Sze Wee in Parliament on Monday.

These figures are likely to fuel concerns that poorer families find it harder to move up the social ladder, as students from poorer homes have a lower chance of getting sought-after government scholarships that often pave the way for a good career in the civil service.In a column last year, recent graduate Soon Sze Meng asked if social mobility is on the decline here.Wealthier and better-educated parents can send their children to better schools, he noted, and they will, in turn, do better and win scholarships.

Sociologist Alexius Pereira of the National University of Singapore took a different view of the numbers, saying they give little cause for worry.It is common across the world for the highly educated to make it into the top social class, he noted. In the United States, students from richer families dominate the newcomer list at top Ivy League universities every year.'At these universities, only 5 per cent are from underprivileged families. In Singapore, half of scholarship holders come from average-income families. That's okay,' he said.

The PSC, which gives out about 50 scholarships each year, stressed that it awards them based on students' abilities and potential, not on their socio-economic background.'PSC scholarships are not study loans or bursaries which are granted based on financial need,' said the director of the PSC secretariat, Mrs Choo Lee See.The statistics appear not to have changed much over the past few years.At a scholarship award ceremony in 2000, PM Lee said 49 per cent of the 110 recipients that day had at least one parent who was a professional or manager. He also stressed then that restricting scholarships to poorer students is not in line with Singapore's principles of meritocracy and equal opportunity.

Dr Pereira also noted that Singapore's meritocratic system ensures that bright but poor students do not miss out.'If you're stupid and rich, you can't buy yourself out of it. But if you're bright but underprivileged, there are enough safeguards to ensure you can still make it.'

I like to believe that tax payers would like to see their monies being used to help those, who truly deserve it. I am referring to poorer, but academically bright students. I have a viable solution that may well work. Award the sum of monies that the scholarship contract is worth inversely proportional to the income of the family. Thus, if a scholar comes from a very rich family, the amount of monies awarded to his scholarship is less or even nil (in the case of a scholar hailing from a family of millionaires) , i.e. a scholar in name. At the end of the spectrum, the poor student should be awarded more monies for his tuitions fees, living expenses and air tickets. I figure this is a more egalitarian way of doing things.

Furthermore, instead of giving out the full sum of monies to the 53% of the scholars from well-to-do families, we can set aside the sum saved and even open up more places for scholarship to poorer students. Before long, PSC would be giving out scholarships to more than 70% of applicants from poorer families living in the HDB heartlands.

Antigen shift in silico

2007-03-26T05:26:00.000-07:00

It would be nice to have a mini supercomputing laboratory right now. I can have a database of influenza virus genome and generate possible combinations of influenza viral genes reassortment in silico. It really gives me a sneak preview on the potentially deadly strains that can arise.

Chemokines and metastasis

2007-03-26T04:30:00.000-07:00

I read a few published papers that carried out an invasive assay, known as the matrigel assay for tumor cells (Wurfel et al, 1999). I realized one weakness - the failure to consider the role of chemokines in metastasis. Chemokines have been shown to be involved in metastasis (Muller et al, 2001). Chemokines can induce chemotaxis in metastatic tumor cells, and allow them to invade other organs. Indeed, the chemokine SDF-1 together with its associated receptor, CXCR4, are involved in the trafficking of normal stem cells and cancer stem cells, which has metastatic potential (Kucia et al, 2005).

In the absence of chemokines from the matrigel, some tumor cells may not migrate. Thus, I believe it may be a little bit premature to conclude that the non-migrating tumor cells have no or little metastatic potential. Perhaps, considerations can be made to coat the matrigel pores with chemokines to mimic physiological conditions.

Chemokines play an important role in cancer biology. Indeed, there is a focus on chemokine antagonists in cancer therapy now (Yan et al, 2006).

Citations

1) Wurfel J, Rosel M, Seiter S, Claas C, Herlevsen M, Weth R, Zoller M. Metastasis-association of the rat ortholog of the human epithelial glycoprotein antigen EGP314. Oncogene. 1999 Apr 8;18(14):2323-34.

2) Muller A, Homey B, Soto H, Ge N, Catron D, Buchanan ME, McClanahan T, Murphy E, Yuan W, Wagner SN, Barrera JL, Mohar A, Verastegui E, Zlotnik A. Involvement of chemokine receptors in breast cancer metastasis. Nature. 2001 Mar 1;410(6824):50-6.

4) Yan L, Anderson GM, DeWitte M, Nakada MT. Therapeutic potential of cytokine and chemokine antagonists in cancer therapy. Eur J Cancer. 2006 Apr;42(6):793-802.

The critic in the age of new media, a comment on 'A*STAR vs Elia Diodati in The Sunday Times, 25th March

2007-03-25T05:28:00.000-07:00

Controversy, sensationalization, gossip, speculation and exaggeration, popular words to describe certain articles, barring the educational, academic and analytical ones.

I would like to reproduce an article published in The Sunday Times, 25th March

A fresh bout of verbal sparring has erupted between outgoing A*Star chief Philip Yeo and a blogger whom the agency threatened to sue for defamation in 2005 By Melissa Sim Mar 25, 2007 The Straits Times IT WAS supposed to be a civil chat over a cup of tea, a chance for two old sparring partners - Mr Philip Yeo, chief of the Agency for Science, Technology and Research (A*Star) and PhD student Chen Jiahao - to air their differences. Instead the online world has enjoyed a fiesty cyberspace spat between two Singaporeans who seem more destined to cross swords than bury hatchets. The last time they clashed was in May 2005 and almost ended in court with A*Star threatening a defamation suit against Mr Chen. This time, the exchange occurred on Mr Chen's new blog and was sparked by his comments, on Feb 16 this year, on a Financial Times article - that appeared on Feb 14 - about the differing views of National Neuroscience Institute director Lee Wei Ling and Mr Yeo over biomedical research here. Mr Yeo saw his comments and suggested on the blog, on Feb 20, that as he was going to visit Mr Chen's place of study - the University of Illinois, Urbana-Champaign (UIUC) - they get together for a chat. Mr Chen, 25, agreed but asked that a third party be present and that the conversation be recorded and posted on the blog. Mr Yeo turned that idea down, telling The Sunday Times: 'As I plan to visit UIUC, I thought I could invite him for tea on a one-to-one basis. Instead, he wanted to interrogate me with a witness and publish our meeting! Arrogant chap.' Then the gloves really came off. Mr Yeo brought up the 2005 defamation incident on Mr Chen's blog. He had wanted to clarify that A*Star had not objected to Mr Chen's comments on A*Star's grade point averages (GPA) policy but took action over accusations it had bribed partner universities and some of their academic staff. Mr Yeo also said A*Star had never asked Mr Chen to take down his website, but to just remove offending and defamatory statements. Mr Chen, who had made an unreserved apology at the time, told The Sunday Times that he was surprised Mr Yeo had brought up the past, especially as the A*Star chairman had previously said he considered the matter closed. But this skirmish was far from closed with the protagonists unleashing a to-and-fro exchange that would have done centre court at Wimbledon proud.

Mr Chen, a former Public Service Commission scholar, hit the first volley, querying A*Star's need for such a high GPA requirement. He cited a supposed A*Star scholar at UIUC who had a mental breakdown because he failed to meet A*Star's 3.8 GPA level.

Mr Yeo hit back: 'Another half-truth or lie? Chap was never an A*Star scholar that I am aware of.'

Mr Chen changed tack, demanding to know if high GPAs necessarily translated into good researchers. Mr Yeo unleashed his forehand - or perhaps backhand - on that, saying Mr Chen's pontificating on R&D talent was like a 'small frog in a deep well' who 'cannot comprehend the majesty of the ocean. Yet it croaks noisily'.

That, retorted Mr Chen, was an attack on my moral character so there would be no point meeting for tea. 'Pity,' said Mr Yeo. The colourful exchanges prompted some onlookers to query if the Philip Yeo leaving the comments was the real McCoy. Mr Yeo told The Sunday Times that he leaves comments only on blogs that run down A*Star and always leaves his name. Indeed, he made it clear on Mr Chen's site that he dislikes blogger anonymity. Mr Yeo said some comments were from 'a rude young generation who hides behind blog anonymity spewing vitriolic words without real knowledge or depth of thinking. Sad for the future of the next generation'. That remark arose after Mr Yeo had painted a scenario of a youngster telling an old man that the old were unable to understand the young because the old grew up in a primitive world without TV, jets or space travel. The old man replied: 'You're right, son. We didn't have those things when we were young...so we invented them. Now, you arrogant little XXXX, what are you doing for the next generation?' That was like a red rag to a bull to the youngsters in the online community. One called Prima Deli said: 'Mr Philip Yeo, I'm afraid your time has passed. NEXT.' Mr Yeo did think some posters were 'rational and honest' and he discussed issues such as grade inflation with them. So any chance for that chat, once the dust settles? 'No,' said Mr Chen. 'Mr Yeo's comments on my blog have led me to believe that he is more interested in calling me names rather than (have an) insightful policy discussion.' And to think it all started with an invitation to tea.

Note: The source is an electronic version. The original page 3 article quoted a set of exchanges between Mr Philip Yeo and Chen Jiahao in Elia Diodati's blog.

I scanned through the hard copy of The Sunday Times, there were interjections of Philip Yeo......Elia Diodati (Chen Jiahao) multiple times. One would be forgiven if he has mistaken the writer of the article for a "boxing commentator". Yet, I saw the word "grade inflation" only ONCE, a subject of great interest to academics, and that is towards the end of the article.

A sad day for the critic indeed. What it takes to be a critic? One who KNOWS his opponents THOROUGHLY, and is able to acknowledge the merits of his opponent's position, yet sharp enough to point out certain weaknesses. The critic does not seek to destroy, but to advance the subject of interest he is addressing, by taking the subject to a higher level.

I am a self-confessed critic of A*STAR's 3.8 GPA requirement because I believe in a set of indicators that reflect a candidate's aptitude for research, yet I acknowledge the merits of the requirement. Graduate schools look out for a good GPA for science subjects, if the applicant wish to pursue a postgraduate course in the science discipline. Admittedly, I was a participant in Elia Diodati's blog and got into a good discussion with Mr Philip Yeo. The discussion went on to a higher level as we discussed the issue of grade inflation. It has been an interesting development as far as the discussion was concerned. Amazing that such an interesting issue warranted a mention ONCE towards the end of the article, and that was by Mr Philip Yeo.

Yet, I find sad that this discussion I was engaged in was portrayed as some sort of a "boxing match". I am not in the habit of "punching" up opponents. I am no basher or destroyer in other words. I find sadder still that the organization A*STAR was made to look something like a boxing federation involved in 2 rounds of bouts, with the supposedly headline grabber "A*STAR spat: Round 2". For an organization with highly qualified personalities in diverse disciplines to be dragged in was really regrettable.

Allow me to be philosophical but I believe the media plays a role in the evolution of a society. Thought provoking articles involving exchanges between personalities from different schools of thought are food for thought. The readers sits up and reflects thoughtfully. On the other hand, articles written to the tune of verbalized boxing matches are junk food to the brain. It simply passes through one ear and out of the other.

Thus, what now is the role of a media? My limited experience as a voluntary journalist during my undergraduate days taught me one thing. To be ACCURATE. When I was first accepted as a journalist for my undergraduate publication, I browsed online looking for materials on how to be a good one. A vitriolic comment lambasting journalists soon caught my eye. It read something like,"the main agenda of journalists is to write controversy for cash". Apparently, I surmised that the commentator must have been suffering the consequences of some articles. There is also a question of ethics. Should interviewees be treated as means to an end or as ends themselves? I always believe that interviewees should be treated as ends themselves, to illuminate their views to all and sundry in the unadulterated form. Of course, editing for language errors still has to be done, but nonetheless, the intended message stays unchanged. It is completely different when a journalist uses his interviewees as means to an end, be it sensationalization, gossip, exaggeration, whatever ostensible end. The consequence is that the unwitting interviewee becomes a subject of unwanted speculation, and worse, innocent parties start getting dragged in.

What now, for readers in the know of the recent spate of events? Remember I spoke about ACCURACY, and for the critic, to know the subject of criticism fully? I understand that Mr Philip Yeo is the main man in the center, and hence, I would urge readers and potential critics alike to read into the main subject matter extensively. I do not know how the article has affected readers' and potential critics' impressions of Mr Philip Yeo, but I will reproduce a series of quotes on diverse topics from Mr Philip Yeo himself in my correspondence with him both in other blogs and my blog. I believe in ACCURACY, hence, the source himself.

I have said my fill, and please, I don't want to be mistaken as an attendant of a "boxing match" in future.

The flu plaque: A continued discussion of evolutionary mechanisms of viruses

2007-03-25T03:37:00.000-07:00

In the past discussions, I mentioned briefly about two or more viruses within a host's genome entering lytic phase, which possibly results in antigen shift, whereby there is reassortment of viral genome giving rise to a deadly virus.

Recently, I found an interesting paper about a pathway of airway epithelial cell infection by macropinocytosis (Ketterer et al, 1999). Macropinocytosis involves the formation of large ruffles in the cell membrane, allowing the cell to engulf large quantities of fluid from its surrounding medium. The influenza virus can be taken into the cell by macropinocytosis (Influenza organism).

Within a host, the process of macropinocytosis may result in the virus particles belonging to the human and animal strains being taken up by the cell, and subsequently lead to infection. The process of antigen shift follows. Macropinocytosis may render the cell vulnerable to infection by more than one viruses.

Citations

1) Ketterer MR, Shao JQ, Hornick DB, Buscher B, Bandi VK, Apicella MA. Infection of primary human bronchial epithelial cells by Haemophilus influenzae: macropinocytosis as a mechanism of airway epithelial cell entry. Infect Immun. 1999 Aug;67(8):4161-70.

2)Sieczkarski SB, Whittaker GR. Characterization of the host cell entry of filamentous influenza virus. Arch Virol. 2005 Sep;150(9):1783-96.

3)Influenza organism http://www.biohealthbase.org/GSearch/Inf_Organism.jsp?decorator=influenza

Can Professor Sidney W Fox's work influence the field of immunology?

2007-03-24T22:42:00.000-07:00

Professor Sidney W Fox was credited with his discovery of life origins. In 5 months time, it will be the 9th anniversary since he has passed on. The brainchild of Professor Sidney's work, the protocells can be synthesized from amino acids and small peptides. Further work proved that these protein spheres can reproduce and divide. Can these protocells possibly be the handy tool of immunologists? Imagine being able to synthesize microspheres made up of a whole range of antigenic peptides. Our immune system is always on the lookout for antigen. Can antigenic microspheres be used as a bait to trick the immune system into a response, and induce immunity to the pathogen itself?

Citations
http://en.wikipedia.org/wiki/Sidney_W._Fox

Mr Philip Yeo, up close and personal

2007-03-24T10:39:00.000-07:00

Foreword

It all started with Mr. Philip Yeo’s engagement of a blogger directly in his own turf, a FIRST NOTABLE attempt by a high-ranking civil servant to directly engage bloggers. I have a personal confession to make. I am one of Mr Philip Yeo’s critics, and still remain one up till this day. I still disagree with A*STAR’s requirements of a 3.8 GPA, however, I figure the best course of action will be agreeing to disagree in a gentlemanly manner. I am not the type who criticizes for the sake of criticism or insult for the sake of insulting. Neither do I belong to the category of “green-eyed bloggers” envious of A*STAR scholars. I am also not in the same category as A*STAR bashers who lambaste A*STAR out of animosity. Better to make new friends is my motto, and I have told Mr Philip Yeo that my blog is open to all visitors, including those from A*STAR. Thus, there is no reason for me to have green eyes over any A*STAR scholar. As a side note, I communicated on the phone with an A*STAR scholarship officer, Edwin, as a nosey and busybody graduate and discussed with him my qualifications and the nature of my undergraduate curriculum. I was told that I was possibly eligible for the A*STAR overseas Ph.D. scholarship. However, it’s my intention to study medicine in a medical school that offers graduate level entry. The only reason why I studied Biomedical Science was because I wanted to know the exact science behind the medicine, and hopefully the knowledge I gained will serve me well later on. I hope to be an oncologist, however I am also open to the field of pediatrics. I have grown to love kids from my current job as a Life Science facilitator. I saw myself as a motivator, helping kids to negotiate learning obstacles in their lives. Before I get carried away with my rambling, readers would like to know how my exchange with Mr. Philip Yeo first started. Well. Initially, I was piqued by a provocative comment (in my opinion) by Mr. Philip Yeo into an initial exchange on Elia Diodati’s blog. Below are the excerpts of the exchange. My moniker was Dr Dee, a DC comic villain whom cartoon network fans might be familiar with.

A SENIOR MOMENT
A very self-important university freshman attending a recent football game, took it upon himself to explain to a senior citizen sitting next to him why it was impossible for the older generation to understand his generation.
“You grew up in a different world, actually an almost primitive one,” the student said, loud enough for many of those nearby to hear. “The young people of today grew up with television, jet planes, space travel, man walking on the moon, our spaceships have visited Mars. We have nuclear energy, electric and hydrogen cars, computers with light-speed processing and…,” pausing to take another drink of beer.
The Senior took advantage of the break in the student’s litany and said, “You’re right, son. We didn’t have those things when we were young…..so we invented them.Now, you arrogant little XXXX, what are you doing for the next generation?

- Mr Philip Yeo

A SENIOR MOMENT REVISITED
An octogenarian came back to a city he once lived in after a long trip. He was surprised by the city’s transformation over the years in his absence, with the landscape dominated by new buildings with modern architecture. He wanted to capture the modern landscape in a camera. He walked into a camera shop and was shown a variety of sleek looking digital cameras. He was taken by surprise because the cameras were so much different from the ones that he used when he was young. He asked the sales personel if these digital cameras needed an external flash and asked why the cameras were so much different from the ones that he was used to during his younger days. The sales personel replied with a smile,”Sir, during your years of absence, your junior generations came up with innovative inventions like the lithium battery and especially the microchip. The microchip that is found in this camera is found in many other electronic devices. Your junior generations’ inventions has not only resulted in new applications, but has also pushed current technologies like photographic technology to new heights.”

- Me (Dr Dee)

This initial exchange was the impetus leading to a series of exchanges between Mr. Philip Yeo and me. Our initial exchanges were about the 3.8 GPA requirement by A*STAR. Being the critic that I was, I naturally took the opposition camp. Both sides presented their side of the story. However, my discussion with Mr. Philip Yeo diverted to other topics later when we commented on Aaron Ng’s (an undergraduate at the National University of Singapore) blog, and later on, in my blog. Even as we stand at opposite camps, off the debating field, I must admit that I am thankful to Mr. Philip Yeo for his kind patience in entertaining my questions. As time passes, blog posts will be archived together with the comments and disappeared into obscurity. Thus, it will be a waste not to consolidate the series of replies and quotes by Mr. Philip Yeo. Many would have formed an impression of Mr. Philip Yeo from the interviews he had given to media. Some will remember him as someone who will not mince his words, and speak his mind. However, I was fortunate to have been given a glimpse into a side of Mr. Philip Yeo that someone reading the mass media would not have been exposed to. I slowly got to learn why Mr Philip Yeo dared to say things that well by his own admission may make readers “hate his guts” (see section 1.2 part iv and section 1.7 part ii). I am sure readers are curious to learn more about the side of Mr. Philip Yeo that they have never been exposed to. For the critics, I will say it’s important to hear their rival’s side of the story, and then make judgements for themselves. Since this write-up is about Mr Philip Yeo up close and personal, I choose not to give a narration but will reproduce quotes by Mr. Philip Yeo in the Blogosphere on diverse topics instead. I will reproduce the quotes in their original form and only edit language errors. I have categorized the topics for easy reference.

1.1 Quotes on his education and early career

i) Only 22 of us in the 1965 class of Pre-University Science students at SJI. In Fall 1966, 11 of us were sent overseas to study Engineering. No Science. No Medicine.To study at BS level only, as the funding was from Colombo Plan donors such as UK, Canada, Australia and New Zealand. – Mr. Philip Yeo on his secondary to university education in a comment on my blog.

ii) The IES (Institution of Engineers Singapore) made me a Fellow many moons ago. Did BS (Industrial Engg) 1970 at U of Toronto on a Canadian Govt Colombo Plan scholarship. 2 years MS (Systems Engg) 1974 at U of Singapore. Offered a U of Spore scholarship to do a overseas PhD in Industrial Engg but I turned it down as it would add another 5 years to my bond period. Went off to Harvard U for the 2 years MBA in 1974 under the US Govt Fulbright scholarship. – Mr. Philip Yeo on his tertiary education and postgraduate years on Aaron Ng’s blog.

iii) Yet 10 years of bond though Singapore paid nothing. Had to serve in the Spore Admin Service (1970 to 1999) though I was an engineer by training and at real work. Never pushed any papers. Pushed weapons design and production in Mindef and from 1986 industrial development at EDB. A*STAR from 2001. – Mr. Philip Yeo on his Colombo Plan scholarship in his response to my queries on Aaron Ng’s blog.

iv) Aid from Canada to Singapore.The recipient must serve his country. He/she cannot stay in the donor’s country. Cannot break bond. - More from Mr. Philip Yeo on the terms of the Canadian Government Colombo Plan scholarship in his response to my further queries on Aaron Ng’s blog.

v) I must have met Mr Tooh Fee San when I visited Chinese High 10 years ago?Teachers like Mr Tooh Fee San will always be remembered. MOE should put up a “Hall of Gratitude” to great teachers like him. Our SJI Pre U (JC nowadays) old Maths teacher Mr. Cheah taught and “tortured” us with weekly Maths tests (Applied Maths and Further Maths then) to vie for the top three names to be placed by him on the class’ plain notice board.That was “The Prize”. Almost the whole class achieved As for the two subjects at “A” level exams. Our Chemistry teacher was a “Master of Disappearing Acts”!Without the physical presence of the teacher, no student could go into the chemistry lab in those ancient days. So the 22 of us pooled our efforts and raised funds to set up a private chemistry lab.No one ever remember or missed the Chemistry teacher. - Mr Philip Yeo remembers some teachers in his comment on Aaron Ng's blog.

1.2 Quotes on Mindef and his relationship with Dr Goh Keng Swee.

i) I started the design and development of the Singapore 155 mm artillery guns when I was in Mindef till 1985 and built them when I led the Singapore Technologies group from 1987 to 1994, even when I was Chairman, EDB from 1986. – Mr Philip Yeo on his Mindef contributions on Aaron Ng’s blog.

ii) Dee,Mindef chaps are not paper pushers. Ha!Philip – Mr Philip Yeo in response to my queries on the way Mindef people work on Aaron Ng’s blog.

iii) I was Chairman, Defence Science Organization Executive Committee from 1976 to 1985. UAV were useful things. - More from Mr. Philip Yeo on his Mindef contributions on Aaron Ng’s blog.

iv) Dee, I was merely relating the old 1985 SIA matter as a joke. I had been in Mindef from June 1970 to Dec 1985 ~~ well past my 10 years of bond. SIA is running well today. In 1985, Dr. Goh Keng Swee thought otherwise of SIA. He really wanted me to go there to fix it as he said. Hard to say NO to Dr. Goh KS. Even when I was at Harvard Biz school in 1974-76, Dr. Goh KS would ask my Perm Sec(Defence) to write to me to come back to Mindef and not waste my time in Boston! When I returned home in May 1976 and went to see him in his office, he went to his big cupboard and personally carried out 10 heavy project files saying: I have kept these for you for the last two years! He would NOT give these projects to anyone else. I was determined to “do it” in 2 years to “get rid” of them. With only 7 years service, not counting the 2 years at Harvard, he made up for the project workload torture by promoting me to Perm Sec (Defence Technology) at the age of 32 plus years-old in Sept 1979. I could not “morally” run away to greener private pastures. Dr Goh always knew whenever I was restless. He would ask: Are you bored? Then he would send more work to me! He said: No one dies of overwork. One dies of boredom. He used to challenge my Mindef engineers and I why we could NOT design and make this or that weapon. Being proud scholar engineers, we would really be hot and angry around our collars. We would then work our butts off to prove him wrong. And when we did it, he will chuckle and congratulate us. The satisfaction that we proved him wrong again was our reward. (Recently, some ignorant young “toady” blogger wrongly called me an iron rice bowled paper pusher!). I learnt the Power of Ridicule from Dr. Goh KS and used it “well” with my chaps too. I have no shortage of private offers. But I think I owe my 2 kids some time with them. – Mr Philip Yeo in response to my query on SIA matters, and an account of his working relationship with Dr Goh Keng Swee, former Minister for the Interior and Defense on Aaron Ng’s blog.

v) Dr Goh KS autographed 3 of his economic books and gave them to me. I have yet to find time to read them! Oops! I usually read science and technology books and ancient history. Whenever I need help on economic matters, I used to go to Dr. Goh KS for free advice. – More from Mr. Philip Yeo on Dr. Goh Keng Swee on Aaron Ng’s blog.

vi) Dee, Dr. Goh read and lectured on military history to our senior officers. His library was a great collection of books. I was only interested in the weapon developments. My collection were weapons. - Mr Philip Yeo’s comments on Dr Goh Keng Swee’s reading and teaching interests on Aaron Ng’s blog.

1.3 Quotes on scholarship matters

i) I reduced the bond to 6 years for the EDB Glaxo scholarship. PSC had no choice but to catch up. For the A*STAR scholars, for 8 years of funding of BS (3 years, 6 years bond ) and PhD (5 years, 5 years bond), I made the bonds concurrent. Hence, total service period is 6 years only. When the scholar comes home after the BS to do the compulsory lab attachment of 1 year, the service obligation is reduced by 1 year. After the US 5 years PhD training, chap need to serve 5 years only. Good deal. Must have high bar of academic standard. - Mr. Philip Yeo on administration of scholarship on Aaron Ng’s blog.

ii) During my 1986 to 2000 tenure at EDB scholars give it a try for first two years after their graduation as they are on probation. If they cannot make the grade, they are allowed to leave for other opportunities. Obviously they have to pay up the remainder liquidated damages of their original 6 years contract. The Chng Hee Kok case was about scholars (1 EDB, 2 NCB) who on graduation did NOT come home to serve at all. One hypocritical chap said that his goal was “to serve the world (US) and not Singapore”. He wanted to be in the US for some 15 years before he comes home. If I had served my 10 years bond, no one can stop me. Right? – Mr Philip Yeo on EDB scholarship and the MP Chng Hee Kok case on Aaron Ng’s blog.

iii) If they want to leave before their 6 years bond is up, they are free to do so with payment of liquidated damages. If they want a transfer to another dept, who wants them, they carry their remainder bond over. Since 1986, very few cases. We are not cruel. – Further elaboration from Mr. Philip Yeo on EDB scholarship when he pointed out my misunderstanding in an earlier posted comment on Aaron Ng’s blog.

iv) When I was Chairman, NCB (1981-1987) I permitted NCB scholars to do their self funded PhD studies after their BS and on their return, transferred their bond to NUS (U of Singapore then). No liquidated damages recovery. Free bodies to NUS. NCB had no funds for PhD studies but did not hold back anyone wanting to do so. Likewise, EDB scholars were free to do their PhD studies on their own and were then released to NUS. Since 2001, EDB and PSC scholars have been transferred to A*STAR for funding their PhD studies. Concurrent bond. Means for their BS (3/4 years) and PhD (3 to 5 years) studies, their bond obligation is still 6 years. During their PhD studies, A*STAR scholars have a home stipend in addition to the overseas stipend and tuition. No compromise on high GPA. No free lunch. - Mr Philip Yeo on NCB, EDB and A*STAR scholarships on Aaron Ng’s blog.

v) PSC scholars from well to do homes can well afford to break bond. PSC would not "name shame" their bond breakers since EDB and NCB named bond breakers in 1998. PSC feared that applicants will shy away from PSC scholarships. EDB (since 1990) and A*STAR (since 2001) have awarded overseas scholarships to young Malaysians who studied in Singapore school and took the same O and A level exams. In the 1990 first batch of EDB Glaxo scholars, I personally interviewed and selected 34 scholars to go to UK and US for their BS/MS in 4 years. 8 of the 34 were Malaysians. Almost all have become Singapore Citizens. For A*STAR, these HUNGRY non-Singaporeans are encouraged to take up Singapore Citizenships.http://www.a-star.edu.sg/astar/front/studentsandscholarships/newsletter/new_sin_scholars.htm

- Mr Philip Yeo comments on PSC (Public Service Commission), and on his role in the selection of scholars EDB Glaxo scholars on my blog.

vi) Not when I am in charge of NCB and EDB. Also A*STAR. Ha! - Mr Philip Yeo, alluding to the fact that NCB, EDB and A*STAR had different scholarship policies from that of Public Service Commission when he headed them, in a comment on my blog.

vii) That was a great article! Genghis Khan chose the best and bravest leaders from ALL levels of society. Not the traditional selection from the noble families. Just as I chose bright and HUNGRY scholars for A*STAR. Over 70 % of them from HDB homes. No sons and daughters of the rich and famous etc. etc. – Mr. Philip Yeo commenting on his selection of scholars on Aaron Ng’s blog.

1.4 Quotes on his educational philosophy and contributions as an educator

i) Good of you to give the Normal Stream students the due attention and encouragement. Like the placebo effect, they can then be self-motivated to succeed. The smart students can fend for themselves. The weak students should be given due attention to make themselves smart. Better teachers for the weaker students to leverage themselves up.When they succeed, they can go autopilot. – Mr. Philip Yeo in response to my earlier blog post describing my teaching experience with Normal Stream students. It is clear he believes that weaker students need better teachers.

ii) I took charge of this school (Queenstown Secondary School) in 1980 for two years to help the kids move up the ladder. The RI and RGS do not need any help from demanding people. - Mr. Philip Yeo in a comment on my blog on his role as an educator.

1.5 Musings

i) The frog used to be a common lab ally for researchers.Now the zebra fish etc etc has pushed it out of the lab table? IMCB has a extra large collection of zebra fish!Can start a zebra fish shop. – Mr. Philip Yeo musing on zebrafish in comment 114 and 124 of Aaron Ng’s blog.

ii) Chap (referring to Fareed Zakaria of Newsweek) is unfair. US is a mature independent nation since 1776. Singapore is a young nation since 9 August 1965. In 1965, our per capita GDP was about US$600. Only 22 of us in the 1965 class of Pre-University Science students at SJI. In Fall 1966, 11 of us were sent overseas to study Engineering. No Science. No Medicine. To study at BS level only as the funding was from Colombo Plan donors such as UK, Canada, Australia and New Zealand. From 1990 to 2000, NSTB gave no priority to PhD education. At EDB, from 1986 to 2000, I gave out over 340 BS/MS overseas scholarships. I took charge of NSTB (now A*STAR) in Feb 2001. Transferred some EDB scholars over to A*STAR for PhD education abroad. In July 2001, we started selecting and sending Singaporeans for overseas PhD training Science and Engineering.

As at March 2007, we have 75 PhD scholars in the US and 11 in the UK. 86 in all.

http://www.a-star.edu.sg/astar/attach/textlet/0e44d2035bWE/PhD-1.pdf

http://www.a-star.edu.sg/astar/attach/textlet/0e44d2035bWE/PhD-2.pdf

Another 200 plus are doing their PhD at NUS and NTU. 240 BS to PhD scholars too.

http://www.a-star.edu.sg/astar/attach/textlet/0e44d2035bWE/bs_by_jcs_(mar07).pdf

Come 2020, they will all be able to play their part and prove this chap (Fareed Zakaria) wrong. :-D - Mr. Philip Yeo in response to an article to an article by Fareed Zakaria titled “We all have a lot to learn” accessible at http://www.msnbc.msn.com/id/10663340/site/newsweek/ in my blog.

iii) The trebuchet changed siege warfare. The movie “Kingdom of Heaven” (Crusaders) showed some trebuchet-looking siege weapons. The Mongols made Chinese slave engineers build the best trebuchet. – Mr. Philip Yeo muses on siege warfare on Aaron Ng’s blog.

iv) Dear Ching Hock, I am not perfect. I try hard to find Cranes (Chinese symbol for wisdom?) amongst young Singaporeans. And some Frogs and Toads hide in their midst. Yuk! I prefer to buy “ready for cooking” frog legs from Cold Storage. Supposed to be good for people with asthma. Philip - Mr Philip Yeo muses on two very different group of young Singaporeans on Aaron Ng's blog.

1.6 Quotes on the future
i) Dee, http://app.sprinter.gov.sg/data/pr/20061222999.htm From the above you can see my role as Senior Advisor for Science & Technology (S&T) to the Minister of Trade and Industry. I am confident that my younger successor Lim Chuan Poh (ex-Mindef like me) who is ably assisted by Deputy Chairman, Prof. Dr Tan Chorh Chuan will be able to carry on and build upon my basement and ground level work of the Feb 2001 to March 2007 period. They know that I have set high standards for them to maintain. Each senior government officer has his/her own capability. I am neither civil nor a servant. I am not indispensable but irreplaceable. We cannot clone ourselves yet. I stayed on and worked for the Singapore government because I had Dr Goh Keng Swee as a great role model. Every time that I was fully tempted to leave for greener pastures, he will call me up for free lunch and load me up with more work to distract me. I could not desert a man who have worked selflessly and have laid the foundation for the Singapore economy that we have today. Philip. – Mr Philip Yeo expressing his vote of confidence in his successor ,Lim Chuan Poh, and a debt of gratitude towards Dr Goh Keng Swee in a comment on Aaron Ng’s blog.

ii) By 2010, we would have given out 1000 A*STAR scholarships. The 2002 BS-PhD batch will be home by 2011.The last BS-PhD of 2010 will only be home by 2019.The aim is to achieve 50/50(ratio of local researchers to foreign researchers) by 2020. – Mr Philip Yeo in a comment on my blog on his aims for A*STAR.

iii) Getting married is a serious matter. Monogamy is not always the best solution. SPRING should aim to have many close girl friends of the likes of A*STAR, EDB, IES, MAS etc etc. Polygamy does pay. Wait for me to go to SPRING on 1st April 2007. – Mr. Philip Yeo, comments on SPRING, where he will assume the position of Chairman in 1st April 2007.

iv) The chaps now running A*STAR, EDB, IES, MAS have worked with me for many moons. I am counting on their help to SPRING to give HOPE and HELP to our SMES. Hope SPRINGs eternal. – Mr Philip Yeo, outlining his hope for the development of SMEs.

1.7 His side of the story

i) Trying to use all means, including Ridicule psychology, to get more Singaporeans, Male and Female, to do graduate studies and to man A*STAR labs and industries etc etc. Have no responsibility for the universities manning. Gender breakdown of 670 A*STAR scholars: 61 % Male, 39 Female. Biomedical Sciences: 48 % M, 52 % F.Physical Science/Engg: 80 % M, 20 % F. The male chaps are just 2/3 years behind the female because of NSF. – Mr Philip Yeo in his comments on my blog explaining why he mentioned in an interview with The New Paper about awarding scholarships to hungry foreigners, who are willing to take up Singapore citizenship. He was willing to use all means including Ridicule psychology to get more Singaporeans to do graduate studies.

ii) YES! :-D Learnt this practice from Dr. Goh Keng Swee: Must be cruel to be kind.They will hate my guts now but when they get their PhD they might wake up and thank me. Ha! Ha! – A reply by Mr Philip Yeo when I asked him in my blog if his “got a basic degree, wash test tube” remark was part of his Ridicule psychology practice.

1.8 Reading materials of interest
i) European and Middle East History from 500 BC. Have a good collection from Darius I, Alexander, the Greek Wars, Genghis Khan etc etc. Now (as of March 17th, 2007) reading a good book: The Great War for Civilisation by Robert Frisk, a journalist. – Mr. Philip Yeo on his collection of books in his comments on Aaron Ng’s blog.

ii) The Sayings of Râmakrishna: 200-299248. Be not like the frog in the well. The frog in the well knows nothing bigger and grander than its well. Means that the noisy croaking frog thinks that his well is the greatest thing in his limited vision. Until he hops out to see the mighty ocean. And when he hops into the ocean, he will be a dead salted frog. Those who know little, makes the most noise. Old English saying: Empty vessels make the most noise. Ramakrishna: His Life and Sayings (2002 Paperback) by F. Max Muller – Mr. Philip Yeo on the Sayings of Ramakrishna in his comments on Aaron Ng’s blog (comments 112 and 130)

iii) I usually read science and technology books and ancient history. – Mr Philip Yeo commenting on his reading interests in Aaron Ng’s blog.

1.9 The family man
i) I am afraid that grandchildren supply will be still a long way to go. My kids are too busy. One slaving away on research. The other still in college. – Mr Philip Yeo’s reply when I spoke to him about family time and possibly playing with grandchildren on Aaron Ng’s blog.

ii) Dee, I chat with them regularly on AIM as matter of habit although we have do use Skype sometimes. Boston and La Jolla, three US hours apart. Philip – Mr Philip Yeo on keeping in touch with his son and daughter, both of whom are overseas.

2.0 FOOD!

i) Ooops! Frog legs are tasty. Ha! I will hunt for the frog legs porridge (when a blogger recommended good frog leg porridge at Geyland Lorong 9). Many thanks!Fish porridge has been my first choice. – Mr. Philip Yeo comments on his choice of culinary delights in Aaron Ng’s blog (comments 113 and 128).

It is my hope that the curious ones reading this write-up will eventually have their curiosity satisfied. For those with a differing opinion, I would urge all those involved to engage in a healthy cum productive discussion, free from ad hominen attacks and mudslinging. If I can do it, so can the rest. After all, I opened this tavern for travellers to make friends over free flow of beverages!

Note: I have received an email from Mr Philip Yeo about an earlier error on the numbers of A*STAR scholars in US and UK, and I have made the corrections in 1.5 part ii. The bold text is the corrected version.

An additional function for NCBI Blast?

2007-03-24T04:00:00.000-07:00

One problem that users face when using the good ol' NCBI to blast short sequences is that the result excludes inverted sequences. Inverted sequences are of interest to molecular biologists studying the activity of promoter sequences. Molecular biologists intending to study different mutations in genes during the course of evolution might be interested in inverted mutations within the genes of study.

Assuming the user wants to BLAST the sequence 5-aggatttcat-3
Result 1:5"---//-aggatttcat---3" Result 2: 5"----//-tactttagga---3"

He would more likely have obtained Result 1. Perhaps inverted mutations can be picked up with the following algorithm:
1) Generate two short sequences for alignment 5"-aggatttcat-3" and 5"-tactttagga-3"
2) Align the upstream and downstream sequences for the hit results obtained for the two short sequences against one another to confirm an inversion mutation.

5"-aggagttgcaggatttcataaggtta-3" 5"-aggagttgctactttaggaaaggtta-3"

For instance, an inversion mutation occured in the above sequence. The upstream and downstream sequences of the two sequences are perfectly aligned with each other except for the short sequence, which is inverted.

The Taiwanese way: A possible marriage between SPRING and A*STAR/other government research institutions?

2007-03-23T11:55:00.000-07:00

My Australia-educated friend happened to mention to me in brief about the Taiwanese promotion of enterprise and I also chanced upon such a discussion in one of the popular forums. The forum had a similar discussion in content to what my friend has mentioned. What I learnt was that as far as the Taiwanese way is concerned, it is quite common for the government research institutions to transfer technologies to the private sector. In Singapore's context, you can think of it as the transfer of a pioneering microchip technology developed under A*STAR to Creative Technology, a private enterprise, as one fictitious example.

I would believe such a matrimonial union between government and private enterprise is beneficial. The government certainly has the hired talents and resources to boost R and D, with a number of research institutions under its aegis. Whilst the private enterprise may or may not have the R and D expertise, it certainly has a good understanding of the market, including the taste of the customers. Consider this fictitious scenario. A*STAR happens to develop an elegant microchip that allows the Creative Zen to execute special functions, which has commercial impact. Creative Technology has a good understanding of the customer base, possessing a good knowledge of popular exterior designs of the Creative Zen that appeal to customers. Part of the profits from the sale of the Creative Zen can be channelled back to A*STAR as royalties for the intellectual property.

SPRING is tasked with the development of enterprises, and clearly R and D support from the government is seen as an ENABLING APPROACH to encourage their growth. Can we envision the marriage between A*STAR/other government research institutions that provide the R and D backbone and SPRING, whose goal is to develop local enterprise? Perhaps, Mr Philip Yeo, the outgoing A*STAR chairman and incoming SPRING chairman, and a prominent visitor in my little tavern would like to provide some inputs.

A potentially radical new approach to genetic engineering and production of precious proteins

2007-03-23T01:56:00.000-07:00

We are currently living in the era of genetic engineering, harnessing bacteria and yeasts for the purpose of producing recombinant proteins.

However, one major setback would be the folding of the recombinant proteins especially within the milieu of the bacterial cells. For example, the Georgiou lab at the University of Texas seeks to understand the physiological basis behind the formation of the correct disulphide bonds.

I doodled a possibly radical genetic engineering method of producing a desired protein in large quantities.

1) The first step involves genetic engineering of a virus that is capable of infecting mammalian cells. The lytic phase promoter elements should be present and should activate the transcription of the gene encoding the protein(s) of interest. The virus should be able to shuttle between lytic and lysogenic phase.

2) Infect an immortal mammalian cell-line, preferably a tumor cell-line that is capable of quick division. The infected tumor cells are allowed to multiply when the virus is in its lysogenic phase, whereby there is potential for transmission of viral genetic material to the daughter cells of the tumor cells.

3) When tumor cells with the embedded viral genome reaches exponential growth, expose cells to stimuli that can induce lytic phase, e.g. stress. There will be production of large amounts of the desired protein during the lytic phase.

I would believe this radical approach is immune from the problem of protein folding since the folding takes place inside the mammalian cell-line. It is able to harness the ability of the virus to hijack the cellular machinery and produce large amounts of its proteins, with the genetically engineered virus producing large amounts of precious proteins instead. It also takes advantages of the ability of mammalian tumor cells to divide quickly, thereby transmitting the viral genome to the daughter cells during the lysogenic phase.

Engineering hybridomas to express other proteins instead

2007-03-23T00:47:00.000-07:00

As an add-on to my earlier post on the use of hybridomas to generate a diversity of antibodies, I was wondering if the gene encoding other proteins and enzymes can be introduced into the hybridoma's genome, replacing the gene that encodes the antibody so that the precious protein can be produced in large quantities.

Dangers of co-opting: A pill for General Arakhan to swallow

2007-03-22T13:28:00.000-07:00

There was a National Geographic segment on the Mongolian invasion of Japan in the 13th century. The Mongols led by General Arakhan had superior numbers and technology (artillery). The Japanese on the other hand had superior swordsmen and a deadly sword in the form of the katana blade, carried by the samurai. In recent times, the katana was compared to the European broadsword and both were equally as devastating. However, the katana was very much lighter than the European broadsword, putting it at an advantage.

However, what did the Mongolian fleet in was the forces of Nature. The Mongolian fleet was out at sea when the typhoon struck. A Japanese scientist, who was featured in the National Geographic segment dived to the bottom of the sea and reclaimed sunken structures of shipwreck. Not all the Mongolian ships were sunken in the typhoon. Only those that were susceptible were sunken. It was believed that the Chinese slave engineers deliberately introduced design flaws, making those ships susceptible. During the Mongolian invasion, there was also infighting involving the Chinese and Korean auxillary forces.

Whilst the Mongolians' way of co-opting made them effective administrators of their conquered territories, their failed invasion of Japan demonstrates the flip side of co-opting.

Singapore's evolution: Time for the rise of the creative class?

2007-03-22T11:35:00.000-07:00

Dear readers:

I sense a healthy discussion that is about to take place, and I would like to keep it warm in the oven. This post can be seen as a response to comments made by readers and an add-on to my earlier posts, the earliest one was on migrants and stayers, and the later one was on how to define talent objectively. I am grateful towards Mr Philip Yeo and other commentators who have offered their opinions thus far.

I developed this idea on the evolution of a society after multiple rounds of discussion with friends, who shared a passion for social development. After multiple rounds of joustings, we sort of came to a consensus regarding the evolution of a society. We dubbed the two phases the "know-how" phase and the "rise of the creative class' phase.

Allow me to start with the "know how" phase. The timeline of this phase is at the beginning of Singapore's development. Basically, the phrase "know how" is an apt term to describe our workforce. An engineer needs to KNOW HOW to engineer, a surveyor needs to KNOW HOW to survey as does a maintainance worker, who needs to KNOW HOW to maintain equipment. It is important for the workforce from the blue collar workers all the way to professionals to possess a KNOW HOW in their job scope. During the early phase of Singapore's development, the government was trying to attract Foreign Direct Investment (FDI), and it is imperative for Singapore's workforce to possess a KNOW HOW in their respective skills.

It doesn't come as a surprise that older generations, who have lived through the "KNOW HOW" era of Singapore's early development, place a premium on qualifications. My grandmother used to exhort the values of doing well in school, urging me to play less and study more. A person's qualifications is seen as an indicator of his hierarchy in society. Professional degree holders with KNOW HOWs in their profession rank above technical workers possessing KNOW HOWs in their technical work. It's human nature to strive to be the top, hence the aforesaid premium on professional KNOW HOWs.

Fast forward till today, the picture is completely different. Cheaper foreign labour have seen the relocation of Multi National Cooperations overseas. Our neighbours are now catching up, and they have the added advantage of natural resources. There's even talk of constructing the Kra canal that will undercut Singapore's lifeline as a port city, although that depends on the Southern Thai separatists' willingness to accept the olive branch of peace. Now, there is a new catch phrase in town - ENTREPRENEURSHIP. Even the Singapore government is promoting it at SPRING. It is at this juncture that my friends and I suggest we are at the "rise of the creative class" phase. Now, a premium is placed on creative thought in developing profitable products, new busines models or completely new businesses. Creativity has got absolutely nothing to do with A grades or good qualifications for the matter. Look no further than EDB's poster boy, Mr Sim Wong Hoo, of Creative Technologies. His former number two, who heads InnoMedia is another example.

Perhaps, it's inevitable that the time has come for the innovative yuppies to steal the thunder. Academic pedigree breeds may find themselves sharing the same pedestal, or worse, knocked off it by the new creative kids on the block.

A possible hope for Aids patients?

2007-03-22T11:29:00.000-07:00

The nature of the HIV virus is such that it targets the CD4 T cells, otherwise known as T helper cells. HIV patients would end up with low CD4 T cell counts.

The T helper cells have a wide variety of functions. They can activate B cells to produce antibodies, augment cytotoxic T cell memory response (Sun and Bevan, 2003) and assist macrophage in bactericidal response. HIV infects T helper cells, and with progression to Aids, the lower T helper cell numbers means that the activation of B cells, augmentation of cytotoxic T cell memory response, and assistance of macrophages are all affected. Aids patients usually die of opportunistic infections as a result of impaired immune response.

It is now possible to generate memory B cells in vitro (Arpin et al, 1995). There lies a possibility of producing memory B cells capable of raising antibodies against known pathogens in vitro from relative donors and introduce them to Aids patients. This will ensure that the Aids patients are still capable of a humoral response. Another important supplement that Aids patient should receive is the anti-CD40 antibody that is capable of acting as a CD40 ligand. CD40 ligand together with CD40 was shown to induce cytotoxic T cell response (Bourgeois et al, 2002 and Sun & Bevan, 2003). Indeed, anti-CD40 antibody was shown to induce cytotoxic T cell response that bypasses T cell help (French et al, 1995). CD40 ligand was also shown to augment macrophage response against intracellular pathogen (Andrade et al, 2005). In addition, CD40 ligand was also shown to have enhanced memory B cell surival (Avery et al, 2003).

Note: Italicized text is a recent addition of mine from a paper, which I have found recently.

Citations
1) Sun JC, Bevan MJ. Defective CD8 T cell memory following acute infection without CD4 T cell help. Science. 2003 Apr 11;300(5617):339-42.

2) Arpin C, Dechanet J, Van Kooten C, Merville P, Grouard G, Briere F, Banchereau J, Liu YJ. Generation of memory B cells and plasma cells in vitro. Science. 1995 May 5;268(5211):720-2.

3) Andrade RM, Portillo JA, Wessendarp M, Subauste CS. CD40 signaling in macrophages induces activity against an intracellular pathogen independently of gamma interferon and reactive nitrogen intermediates. Infect Immun. 2005 May;73(5):3115-23

4) C. Bourgeois, B. Rocha, C. Tanchot, Science 297, 2060 (2002)

5) French RR, Chan HT, Tutt AL, Glennie MJ. CD40 antibody evokes a cytotoxic T-cell response that eradicates lymphoma and bypasses T-cell help. Nat Med. 1999 May;5(5):548-53.

6) Avery DT, Kalled SL, Ellyard JI, Ambrose C, Bixler SA, Thien M, Brink R, Mackay F, Hodgkin PD, Tangye SG. BAFF selectively enhances the survival of plasmablasts generated from human memory B cells. J Clin Invest. 2003 Jul;112(2):286-97.

To objectively define talent

2007-03-21T10:39:00.000-07:00

Dear readers:

I would like to continue the debate on a topic that has been brought up in Aaron Ng's blog. I touched on this issue a bit in my previous blog post on "migrants and stayers". Mr Philip Yeo has kindly commented on my blog especially on the issue of talents, and hence, I would like to keep this issue alive.

First and foremost, I would like to highlight excerpts of SM Goh's speech.

"Singapore, he said, is leaking talent. Not just ordinary talent, but its best and finest."

"The issue which we are most concerned with is the loss of our own people at the very top," said Mr Goh. "These are bright young people, children of very well educated Singaporeans."

I would assume he was referring to the loss of academically bright young people, whom he described as talented. Now comes the debate. Is talent associated with academic achievement? From what I have noticed, there do not seemed to be much correlation. There are readers here, who can attest to the fact that there straight As students in GCE "A" levels who do not perform well at unversity level. Of course, there are exceptions and there are GCE "A" levels high-fliers who go on and do well in university. A fair number of our government scholars are shining beacons of this fact. However, then again, the counter-arguement is that if one is exam-smart, he would do well under examination conditions at any level, a fact acknowledged by one of my Professors who happened to have an interest in undergraduate education. I had the pleasure of speaking to someone from the education service and he seemed to equate good grades with meritocracy from what I could gather.

Allow me to produce the first definition of meritocracy from dictionary.com.
"an elite group of people whose progress is based on ability and talent rather than on class privilege or wealth".

Of course, I didn't have the heart to tell this chap that I managed to ace my "A" levels due to a foolproof exam-smart tactic that I picked up from my seniors, allowing me to mug for three months to get my As, whilst the large part of my college years was spent in playful abundance. Did I deserve my As on merit? Hardly.

There was an article by Fareed Zakaria of Newsweek on the comparison of Singaporeans with Americans. It can be accessible at http://www.msnbc.msn.com/id/10663340/site/newsweek/

There was a telling admission by Mr Tharman Shanmugaratnam, our education minister, from what I have perceived.

I reproduce the excerpts of a quote by Mr Tharman below:
"We (refers to Singapore and America) both have meritocracies," Shanmugaratnam said. "Yours is a talent meritocracy, ours is an exam meritocracy.

There was another interesting piece by the author:
"He's the minister of Education of Singapore, the country that is No. 1 in the global science and math rankings for schoolchildren. I asked the minister how to explain the fact that even though Singapore's students do so brilliantly on these tests, when you look at these same students 10 or 20 years later, few of them are worldbeaters anymore. Singapore has few truly top-ranked scientists, entrepreneurs, inventors, business executives or academics. American kids, by contrast, test much worse in the fourth and eighth grades but seem to do better later in life and in the real world. Why?"

I have commented earlier in Aaron Ng's blog that talent does not necessarily co-exist with academic excellence. I happened to have a chat with a good friend of mine over some drinks. Both of us happened to read this artice by Fareed Zakaria. We both uanimously agreed that scoring well for science doesn't mean being good in science. Someone who is considered good in science should be able to DO GOOD SCIENCE. Any good scientist should be able to come up with a hypothesis and test it, formulate a model and test its consistency with observed scientific phenomenon. The judgement of this ability lies not so much in academic transcripts, but rather feedbacks/recommendations from academic advisors and publication records.

Thus, it can inferred that talent should be defined based on performance as opposed to standardized test. If we want to identify a Beethoven or Vladimir Horowitz reincarnate, we would be better off observing the fellow's piano performance as opposed to being focused on his grade XX theory examination, right?

Mr Philip Yeo asked me in his passing comment to show him the talent. My reply would be I have none at the moment. However, I would like to add that Tuesday (two days ago), it was one of my happiest days of the year. I am currently a Life Science course facilitator and I had to take a Normal Stream (the lowest tier in the hierarchy of secondary school stream) class for their Life Science course. I showed them a demonstration of serial dilutions and asceptic techniques ONCE. Furthermore, the conditions of the lab was not really sterile with no biosafety cabinets, and with just a blowing fan on top that would have blown an impurity on the agar plates. However, close to 50% of these Normal students obtained good bacterial culture plates (with visible colonies and minimal signs of impurities), beating their express (higher tier than Normal Stream in the hierarchy of the secondary school stream) who had close to none good bacterial culture plates. I thought it was a remarkable achievement considering the fact that the containers used were not exposed to sterile treatment, and that I had gone through the demonstration only ONCE! Even their teacher in charge was extremely happy with their performance that he took a few pictures of their masterpiece! I swore to myself that I must impart to them at least one part of the Scientific Method, important skills that allow these future talents to conduct experiments effectively as future scientists. I DO NOT BELIEVE in regurgitating what is needed to be reproduced in examinations, I rather impart important skills that one needs to perform in his task. It's the establishment's next move if one of these future talents comes knocking on its doors. I just hope that their academic record will not disadvantage them.

A possible bioinformatics resource to evaluate possible cytochrome P-450 - xenobiotics interactions

2007-03-21T10:01:00.000-07:00

As an add-on to my earlier discussion on the "PharmaBLAST" algorithm, I spoke of modifications pertaining to the PASS algorithm, fill spheres representing C, N, O, etc, and possibly generate structures of different properties from the hydrophobic ones to the hydrophilic ones that can fit into the crevice where the active site is, depending on its properties. The structure that fits into the active site can be extracted and recorded into the database.

Such a resource should have two layers of comparisons. The first layer involves a comparison with available pharmacophores in the database and the second layer involves a comparison with structures fitting into the active site of cytochrome P-450 enzymes. This will allow researchers to know in advance the possible cytochrome p-450 enzymes that their candidate drug or xenobiotic may react with.

Citations
1) Kemp CA, Marechal JD, Sutcliffe MJ. Progress in cytochrome P450 active site modeling. Arch Biochem Biophys. 2005 Jan 15;433(2):361-8.

Back online after being unplugged!

2007-03-21T09:53:00.000-07:00

Dear readers and commentators:

I wasn't able to personally serve drinks for the past few days in my little tavern because my modem practically went bonkers and I had to get a new one. Hence, I wasn't able to reply to comments ASAP. However, I am glad to be back online.

A possible mechanism for the evolution of the killer virus?

2007-03-18T05:31:00.000-07:00

Virology studies have come a long way and a wealth of scientific literature has been written about the subject. Yet, some viruses remain one of the most elusive stealth fighters ever known to mankind.

Take the cytomegalovirus or herpes virus for example. Both are known to go into stealth mode by entering a latent or lysogenic phase. During this phase, the virus lies dormant within the genome of the infected cell. Even the common cold virus is capable of hiding and remaining dormant within the genome (ScienceDaily). It has been thought that influenza lies dormant in humans (Knowledge of health).

Under certain stimulus, the dormant virus can become active, resulting in the production of new virus particles. This is known as the lytic phase. There lies a possibility of a cacophony of viruses residing within the cell all in the dormant phase. However, they could be chugged into life by a stimulus, which results in the production of viral particles. If that happens, there lies the possibility of antigen shift, resulting in the reassortment of viral genes from more than one species of viruses.

The thought of more than one virus infecting the cell, lying dormant until a stimulus resulting in production of viral particles with the possibility of antigen shift is attractive if we studied the pattern of killer virus outbreaks. There lies a period of dormancy for a number of years followed by an outbreak of a new strain of deadly virus. Indeed, we are facing an evolving stealth fighter of destruction.......

Citations
1) Anders DG, Punturieri SM. Multicomponent origin of cytomegalovirus lytic-phase DNA replication. J Virol. 1991 Feb;65(2):931-7.

2) Researchers discover cold virus can "hit and hide". http://www.sciencedaily.com/releases/2004/04/040426055429.htm

3) http://www.knowledgeofhealth.com/report.asp?story=Why%20Flu%20Epidemics%20Occur%20in%20Winter&catagory=Infectious%20Disease,%20Vaccines,%20Flu,%20Vitamin%20D

3) Introduction to the viruses. http://www.ucmp.berkeley.edu/alllife/virus.html

Of migrants and stayers

2007-03-18T03:39:00.000-07:00

This piece of musing is a follow-up from Elia Diodati's and Aaron Ng's blog on the issue of migrating Singaporeans. The issue of brain drain is quite ancient whereby it is being repeated ad nauseum in media, forums, blogs, etc, and the catch phrase for it is migration, a word that I prefer to the politically loaded term "quitter".

It remains to be seen if scientists can prove with certainty that the ability to migrate is one of the primal instincts in higher animals like Man. I will certainly not doubt that our ancestors desired to seek an oasis of plentiful resources that they made the choice to cross mighty oceans from all corners of the globe and settle in this Lion City. Fast forward to more recent times, it seems that this very primal instinct to migrate is revitalized in later generations of Singaporeans as they desired to seek pastures abroad.

Whilst our leaders expound the value of loyalty to one's country irregardless of the circumstances that one faces, one must acknowledge that such a form of altruism is a rarity. Loyalty to one country is nowadays a form of commodity traded in exchange for say, a security of livelihood or the opportunity to fulfil one's dreams. Thus, for the remainder of my write-up, I would discuss the reasons as to why Singaporeans set their sights on destinations beyond our shores.

The first reason is the topic of disillusionment amongst Singaporeans especially the young. They are talented in their own capacity, yet the system established DO NOT RECOGNIZE their talents. The end result is that these people are thrown out of the system and denied of an opportunity to nurture their talents. As a result, these people become disillusioned, and feel that Singapore is not the place to develop their talents. If they are given the opportunity to nurture their talents in overseas destinations, usually these people would stay on overseas.

The second reason is the limited diversity within the Singapore sphere. Are there opportunities for budding rocket scientists (rocket designers for space and NOT weaponry), the Winter Olympics hopeful who loves winter sports, our future astronautical engineers or nuclear physicists? It's an inevitable fact that Singaporeans with such aspirations will seek their playground elsewhere.

The third reason is the relative cheapness of air travel. Budget airlines that ply air-routes within a region allow Singaporeans to get quickly from one place to another. Singaporeans settling in other lower living costs countries in the Asian region can take advantage of budget Airlines to keep in touch with relatives in Singapore. The upcoming Airbus A380 that is capable of direct flight from Australia to Chicago will be the future of air travel, and will allow relatives from further destinations to travel at greater convinience.

The fourth reason has more to do with the Singapore system's (legal) tolerance with certain categories of people. It has to be said that our laws are in a way not conducive towards certain minorities like the homosexuals for instance. Don't get me wrong, I am not a homosexual by any means (a straight in fact), but I would like to relate accounts from my friends who are homosexuals. I know of a friend who is one. He studied overseas and grew to like the country where he completed his undergraduate studies because of its tolerance towards gays. Comparing it to Singapore that criminalizes acts of homosexuality, he made the choice to stay on in the foreign country because he found its tolerance of gays a pull factor and Singapore's criminal prosecution of homosexual acts a push factor. He was considered a talent in his field, and was head-hunted before he even graduated. These are the type of top brains that Singapore will eventually lose, a sentiment echoed by SM Goh. This situation was not helped either with the constant encroachment of religious lobbies calling for the criminalization of homosexuality and lesbianism. On a lighter note, I would suspect die hard gum chewers might find Singapore a little inconducive, because it may be a little hard to purchase gums, and secondly, they need to get a medical certification.

Perhaps, the issue of migration is a consequence of globalization. We may do well to recall the old adage,"The world is our oyster". As it is, the world is increasingly seen as the travellers playground that even my humble little tavern is nothing but a temporary stop on the traveller's highway. As much as I want travellers to stay on in this tavern of mine, it is inevitable that they would resume their journey on the highway..........................

Commentary on Richard Dawkins Part 4 - The bioenergetics perspective

2007-03-18T00:36:00.000-07:00

A Professor in animal physiology once told me, if a particular gene is not needed in an environment, it's better off not being expressed, or should I say "dead" in the metaphorical sense. The gene will become a fossilized remnant in our human genome or better still, become deleted.

This Professor of mine is more of a physiologist rather than an evolutionary biologist. However, I find his academic opinion interesting and refreshing nonetheless. He has a penchant for viewing the topic from the standpoint of bioenergetics. The copying of genes via the process of DNA synthesis and even the transcription of genes is energetically expensive.

Thus, if an organism were to migrate to a location where the gene(s) is/are not required for survival, the gene(s) is/are better off deleted, so that the energy resources saved can be directed for other more important purposes. Thus, the fate of the selfish gene to propagate lies in the question of its necessity, and whether it will be energetically favorable to persist with production of copies and transcription. If it's no longer needed, deleting it will save precious resources for the cell.

A rhetoric call for rebellion against the gene was made, yet the silent rebels have been waging this rebellion since the beginning of evolutionary time.